I have designed forward and reverse primers between BamHI and XhoI respectively to clone a 1-360 bp segment of bacterial gene
pET-30 a (+) (5422 bp). I'm designing a cloning primer just first time and wondering how to analyse that my gene of intrust is inframe.
atccggatatagttcctcctttcagc(terminator)AAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAgttattgctcagcggtggcagcagccaactcagcttcctttcgggctttgttagcagccggatctcag(histag)TGGTGGTGGTGGTGGTGc(XhoI)↓TCGAGCAACGACAACAAGACGCGCGACAAGACGACCAACAACAAGCGCAACAAGACCCACCACAACGAGCCAAATAGAAAGCCAAATAGAAATATCGGCGGAAGGCCGCCGCGTTATTACAAGTCCGGGCGCGAGACGGTGTCTAGGTCCCACGGTTATACCCAAAACAACGAGCGTTATTACGGGCGGACGCGGCGCAATACTAGCGGGTGCCAGTCTACCAATTTCAAGTGAAGCGGCCAGTGAAACGACCACAATTACCACGATATCGAGCCGCGGTCTATGCGCGGGTGTATGACGTCCGCCGGGTAGGTGTGCAACGGGTAGTCAAAGTGCGACAACGAGCGGTCCAAGTCCCAGCGCGGTAGTATGTCCGATTAAAGGCGCAAAAACGACGACCATTACGGAAGCGAGCGGACGTCCCAGTCGTGCCACGACGAGCGAAACGCCGGGCGCGGCGACGGGTGCGCCAACAATTAAAGGTCTTTCAATAGTTAGTCTTACAAAAAGCGCAATTTTAGGTGCGCCCACCACGCTAGGCGCGATAGAAATATCGACCATTTCGACAACGGCAATTTGACCGGGTCCGCGTCCCAGCGAAAGACGTACAAGTGTAGGTCTAGCGGCGGCCATTTCAACGCGTCCGGCGAGTCCAATATCCACGGGTGGCGTAGAAAGTATAGGTGAAGGTCAAACAAGGTGACCGGCGGAAAGTGGGTTATTACCCAGCGGCGCAACGGGGTTAGGGTCGGCGGTAGTTAAAACGACGAGTCGTCCGACGCTATGTCTAGTATAAGAAACAAGCCTTTAAGCAATTTCGGAAACGGGCGGACTTACGCGGTGTGAAATAGGCCAAATAGGCCCCAAAACAAGCGAAGAAGGCGGACAAAGTCCGGGGTCGGGTCGTCCGGCGAGTGCCACGGGTGGCGGCGCGGCCAGCGTTACGGCGGGTGTTAGCGGCCTTATTAGTGCCACCATTTTTTGCGGCGTACCGAGACGACGCCCCATTACGAGTGGTCGCGCGGGTGGTCGCGGTCCGAGTGGTCGCCCGCCAATTAAAACGCTACCCAGACGACTTAAAGGTACCTAG↓(BamHI)gatccgatatcagccatggccttgtcgtcgtcgtcggtacccagatctgggctgtccatgtgctggcgttcgaatttagcagcagcggtttctttcataccagaaccgcgtggcaccagaccagaagaaTGATGATGATGATGGTG(histag)catatgtatatctccttcttaaagttaaacaaaattatttctagaggggaattgttatccgctcacaattcccctATAGTGAGTCGTATTA (promoter)
In pET-30a(+) , the translation occurs on the other strand of DNA; it appears to be from right to left (5' to 3' certainly, but it just looks unintuitive).
CATatgtatatctccttcttaaagttaaacaaaattatttctagaggggaattgttatccgctcacaattcccctATAGTGAGTCGTATTA (promoter)
The CAT (ATG on the other strand) highlighted above is from where the first amino acid is incorporated, i don't know your protein sequence, so you need to check the possibility of frameshift yourself.
Hi Sandeep,
You can use SnapGene to check whether your insert is in-frame or not.
Hi there,
In pET30a BamHI site GGATCC is actually in frame with the ATG therefore the design of your forward primer will have to respect the frame GGA TCC. For the reverse primer you should introduce a stop codon right upstream of the XhoI sequence in order to avoid the downstream His tag (as there will be a His Tag between ATG and BamHI...). Careful, I have tested the sequence in bold you have inserted between the BamHI and XhoI sites: there are a lot of stop codons in the 6 reading frames... Which is not compatible with expression in bacteria.
- Badges
- Science method