Hi all,
I am trying to amplify naked mole rat CD44 from CDNA. Sequence of CD44 is taken from http://www.naked-mole-rat.org/annotations/details/XM_004852041.1/.
I want to amplify CD44 cDNA. The primers i generated are as follows:
NMR_CD44_EcoRI_F 5` TAAGCAGAATTCATGGACAAGTTCTGGTGGCG 3`
NMR_CD44_EcoRV_R 5` TGCTTAGCGATATCTTACACCCCAATCTTCATGTC
Basically, I want to add EcoRI at 5 ` and EcoRV at 3`.
When I do the PCR with these primers using CDNA, I do not see even a smear, let alone a amplified band. I only see very bright band of primers down of the gel.
I hope the primers are fine.
Any suggestion would be appreciated.
Many thanks
The Forward primer is pretty bad. Many time, it would be more straight forward to synthesis a gene (cheaper and faster) instead of using cDNA.
use a hot start enzyme to reduce the primer dimer and touchdown pcr to a temperature of abot60c just to get good amplification and clean in the early cycles then you can increase the annealing temperature appropriate to the full length of the oligos, In the first cycle only the gene specific 20 bases will anneal of the primers. once you have aproduct the primers will be incorporated and the whole primer will stick
I think your PCR condition need to be optimized for these primers
check annealing temperature, initial denaturation and mgcl2 concentration
What I usually do when everything fails is to design a new set of primers to amplify the cDNA including the 3' and 5' UTRs. This allows you to choose a wide variety of primers with much better parameters in terms of Tm, primer dimer and self dimers and the amplification will most likely succeed. Then, you can use your pcr product as a PCR template using your current set of primers, greatly improving your success rate. I personally found that subcloning the UTR-containing product into a vector such as pGEM or pJET and using the plasmid as a template work even better!
Good luck...
- Badges
- Science method