Here are the things :
4kb tagged DNA
Extension time provided is of 4 minutes
DNA concentration is about 1995.6ng/ul
I used 1:10 and 1: 100 dilutions as well but still not getting the band.
Please provide insights
What length and annealing temperature are your primers. Is there any primer dimer after amplification. Is the template GC rich or might have significant seecondary structure problems. It may be worth treating it as high GC or AT and using dmso at up to 8% or running the assay in 1M betaine. Have you run an annealing temperature gradient?. What is the origin of your dna and does it have a good OD260/280?
Annealing temperature = 72 degree
FORWARD primer =20 bases
Reverse primer = 21 bases
No primer dimer after amplification
I have already used DMSO for the same
No I haven't run the annealing temperature gradient yet
72 c is very high for a 21 mer to anneal.I think that your primers are not annealing unless they are enormously high GC. Can you give your primer sequences please?
But phusion works at this annealing temperature .
FP -. 5 TGACGTGGTTGTTGAGTTTG 3
RP. -. 5 TTCAAATTCGGTAGCACATTA 3
One correction . Sorry. I have used annealing temperature of 63 degree actually
The melting temperatures of these primers are 50 and 53c. This is too low . You really need to make the primers longer to raise the annealing temperature of the primers. If you amplify 4kb out of a complex genome at very low temperatures then the template sequence will form secondary structures and the strands will reanneal before the primers have a chance to anneal and extend. You could try apcr at 50c with added 1M betaine to help the template melt but I think that the real answer is new longer primers
If you know the sequence of your template then align the primers against that sequence. Then add the next 5 bases to the 3' ends of each primer and check the annealing temperatures are well above 60c and also check that there is only a low probability of the primers forming primer dimers
- Badges
- Science method