01 January 1970 0 666 Report

A retrospective assessment of graduate outputs with regards to human capital trends among public universities in Ghana.

Recommending articles and/or journals will be much appreciated.

More Dennis Appiah Wiafe Akenten's questions See All
How to carry out micro preparation of Zn-2 (Zamak 2) sample surfaces?

I am currently struggling to achieve a good surface finish on mounted Zn-2 samples. Both grinding and polishing (with SiC, silica and diamond) resulted in embedding of the grinding/polishing media...

11 June 2024 2,055 0 View

FFPE mouse femurs appear to have internal bubbles?

I am wondering if this is a technical issue that occured during processing. I have murine femurs that were decalcified in 15% EDTA over 2 weeks and then processed and I embedded them into FFPE....

02 April 2024 6,382 2 View

Is it necessary to include an FMO for 7-AAD dye in your Flow Cytometry experiment? If not, why?

I'm optimizing a flow cytometer experiment and one of my three stains is a 7-AAD Live/Dead stain. The other stains in my experiment are staining for CD34+ and CD45+ cells. Is it necessary to...

01 April 2024 3,060 0 View

What is best way to get lowest adsorption site at subsurface of high entropy alloys?

I am currently studying diffusion of oxygen in high entropy alloys. I want to calculate the activation energy from an adsorption site on the surface to the subsurface. I placed the oxygen atom...

26 March 2024 3,268 0 View

Examples of gender norms that affect men and women's participation in agriculture?

It is a course unit called gender and social economic issues in development ARX 1201

07 January 2024 365 0 View

Is it necessary to to conduct independent simple regressions for a multivariate regression model or this can be derived from the multiple regres?

The objective here is to determine factor sensitivities or slope coefficients in a multiple ols regression model.

17 August 2023 7,825 5 View

Does anyone had problems installing Cytoscape in Ubuntu 22.04.2 LTS?

I am trying to install Cytoscape in Ubuntu 22.04. I followed the instructions on the official website and installed Java 11, 17 and 18. None seems to work. I had this error every time: Error:...

30 May 2023 9,889 2 View

Why is it that when I open a structure and I select atoms in Vesta it crashes immediately?

I am trying to work on a structure in Vesta. But after opening, it crashes when I select atoms to delete. Any help would be deeply appreciated

07 March 2023 5,805 4 View

Working primers for human NPC1 and TrkB qPCR?

For one of our experiments we are planning to run a qPCR on cDNA from human samples. In our first test, we found that our primers for TrkB (forward: ACAGTCAGCTCAAGCCAGACAC, reverse:...

24 January 2023 4,508 3 View

Can standardize test be a data collection tools for descriptive study?

Good day scholars, I am doing a descriptive study and want to administer a standardize test, is it possible?

21 September 2022 6,517 1 View

Similar questions and discussions
Hello Everyone ! I'm looking for a good journal to publish my manuscript with low publication cost?

I am Looking for a Science Journal with good impact factor and low publication cost to publish a review paper. Your suggestions would be appreciated.

06 August 2024 6,796 3 View

Is Galaxy.org good to use for research for analyzing data and for publication?

Hello all, I wanted to know, can I use galaxy (USA, Europe or Australia) platform for analyzing the shotgun data, and can it be used for publication purpose as well? Thanks :)

06 August 2024 6,610 4 View

How to convert a privately loaded document into a public document?

I attempted to make a privately uploaded text public but a window appeared that said an error occurred. There was no explanation provided as to why there was an error or what might be done to...

05 August 2024 8,025 7 View

Who of all the Global Scientific community will help me Prof. Dr. Yoshida make way for TPEOM, MEC ~EMC to return the atmospheric gases to the norma ?

TEP presentation caption (The Environmental Project) Re: Why should Washington’s DC, or any country government point of location think of as nowadays of as to being 'tomorrow as to come! if it...

03 August 2024 2,484 1 View

Which is more important: The human factor or the technological factor in combating climate change?

On a personal note, even though technology has attracted a lot of interest and funding to combat climate change, it is becoming more and more clear that taking care of the "Human Dimension" is...

02 August 2024 6,773 12 View

How to send my account link and how to make my account public?

Nothing

01 August 2024 755 1 View

How to retain the a GFP tagged gene expression in stable cell line?

Hello , I established a stable cell line expressing GFP tagged to a centrosomal gene having G418 drug selection marker. I validated the stable line by IFA and Western blotting, results are fine....

29 July 2024 5,007 0 View

How can productivity (using the Google form link below to provide your answers) be achieved in manuscript publication?

Survey on Productivity in Journal Manuscript Publication Survey Form Link: (https://forms.gle/YRVrn8dL4WZJJ79S8 ) Dear Researcher, We kindly invite you to participate in our survey focused on...

29 July 2024 4,116 1 View

In terms of chaos, what is the necessary and sufficient condition for authoritarianism, permanent or temporary, to come to exist and persist?

Since 2016 Brexit, the world needed to change the thinking behind traditional democracy as the democratic landscape changed, yet traditional democratic thinkers and actors have been acting as if...

28 July 2024 6,515 1 View

What is effective targeted chaos?

Perfect democracy thinking assumes no chaos so no need for independent rule of law system and liberal democracies assume the possibility of normal democratic chaos that can be sorted out by an...

28 July 2024 473 1 View

Our partners will collect data and use cookies for ad personalization and measurement. Learn how we and our ad partner Google, collect and use data. Agree & close