Dear all

I would like to model a miRNA-mRNA duplex 3D in pdb format using prediction tools. I have used viennaRNA package by RNAfold using the following command

"$ RNAcofold -p --noGU < mRNAmiR.seq"

(where mRNAmiR.seq contains miRNA sequence and its target mRNA sequence). The input sequence contains the miRNA seq followed with target mRNA using "&" as concatenate element in the string.

The output provided a dot bracket secondary structure RNA as UUCUGUGUUUUAUCUAGUCACAU&UGUGACUGGUUGACCAGAGGGG

.((((.((.....(.(((((((.&))))))).)...)))))).... (-13.10)

and as well as a secondary structure RNA in PS format (image attached below)

Using RNAcomposer webserver, I tried to model 3D miR-mRNA. The RNAcomposer couldnot take the symbol "&" in the dot bracket as well as FASTA seq in the query. When I try without the "&", it give the result of single stranded 3D RNA having loop with miR-mRNA duplexes.

could anyone suggest me a tool to obtain a double stranded RNA duplex.

I have tried perform it in UNAfold, but i couldnt find the sourcecode for the UNIX shell in their website.

Your help is highly appreciated and I express my deepest thanks in advance!