How to measure actin-cortex width of the interphase cells? Any ImageJ plugin available?

Does any one know how i can prepare liver tissue with transmission electron microscope with good fixation?

i have problem in preparation of liver tissue with bad cell organelles and how i can adjust osmolarity

03 March 2021 8,890 1 View

Can someone suggest a way to prepare slides to observe under confocal microscope for observing fluorescent tagged proteins??

I am growing the cells on coverslips and transfecting the fluorescent tagged protein directly on them. Then i want to observe these cells under confocal microscope. Currently i am just using...

01 March 2021 6,142 3 View

Can anyone help me how to get the similar bands in Actin?

I run western blot on HCT-116 cell lines, I got actin band like in the attached picture. The band size is not same. Can anyone help me explain this situation and how to overcome? Thank you your...

22 February 2021 6,937 3 View

Hi, can anybody help me with the suggestions how can I amplify a stress induced gene of 1107 bp?

I am trying to amplify the TGA1 (Transcription factor 1 ) of Arabidopsis ,which is 1107 bp. I have treated the plants with Salycylic solution over night and extracted the RNA and make cDNA. I...

17 February 2021 7,802 2 View

Troubleshooting with immunofluoresence/confocal microscope? What went wrong?

Hi guys, I have no experience and little knowledge on immunofluorescence and confocal microscopy. I tried to visualize the expression of FXR in my cells (THP-1 macrophages), yet I did not...

11 February 2021 562 6 View

Why are my western blot bands so distorted?

Hi guys I'm out of ideas here please help! I've never had consistent problem like this doing westerns before and I can't figure it out. The condition used: - First 4 lanes have 50ug protein in...

04 February 2021 2,297 3 View

In your view, which current SEM is most recommended for EBSD/TKD and EDS analysis?

I know that this is a very difficult question, as the areas of application can vary greatly. However, if you want to operate low as well as high resolution (from a few millimeters to nanometers),...

02 February 2021 4,985 4 View

Does the pre-synaptic neuron location in a cortical map influences the spatial position of its synapses in the dendrite of the downstream neuron?

Are functional maps in the cortex used by the brain to carry out computations or are they just a byproduct of wiring minimization? A key element to answer this question is to know if, when...

26 January 2021 1,118 8 View

After G actin polymerization and labelling I didn't got filaments. Why?

Purified G actin and got 42kda band and an additional band just below it. While performing G actin polymerization and labeling with rhodamine-phalloidin I didn't observe filaments under the...

20 January 2021 3,751 2 View

Why am I seeing multiple bands for beta-actin PCR?

I performed a PCR run on human DNA with the beta-actin primer (F: GCCATCCTGCGTCTGGACCTGGCT; R: GTGATGACCTGGCCGTCAGGCAGC). PCR setting: 98degree 30sec, 30cycle of (98degreeC 10sec, 64degree 30s,...

14 January 2021 6,544 2 View

Johanna Marie Dela Cruz

Hi Harsh Oza . Could you possibly provide an image? Is it a 2D or 3D image? Is the actin cortex labeled with a fluorescent dye?

Harsh Oza

Hi Johanna Marie Dela Cruz

My Images are confocal images and the actin is stained with Phalloidin 594 (Paraformaldehyde fixation).

I have attached an image (max projection) below. I can provide the whole Z-stack image in TIF format if required (through email).

Thanks in advance

Regards,

Harsh

Hi Harsh Oza. You could try thresholding your image first. Under Analyze > Set Measurements, check the Bounding rectangle option (as well as other parameters you want to measure). When you use the Particle Analyzer, you should get length and width measurements.

Johanna Marie Dela Cruz Thanks for the suggestion.