Can anyone help me how to get the similar bands in Actin?

I run western blot on HCT-116 cell lines, I got actin band like in the attached picture. The band size is not same. Can anyone help me explain this situation and how to overcome? Thank you your...

22 February 2021 6,937 3 View

Hi, can anybody help me with the suggestions how can I amplify a stress induced gene of 1107 bp?

I am trying to amplify the TGA1 (Transcription factor 1 ) of Arabidopsis ,which is 1107 bp. I have treated the plants with Salycylic solution over night and extracted the RNA and make cDNA. I...

17 February 2021 7,802 2 View

Why are my western blot bands so distorted?

Hi guys I'm out of ideas here please help! I've never had consistent problem like this doing westerns before and I can't figure it out. The condition used: - First 4 lanes have 50ug protein in...

04 February 2021 2,297 3 View

After G actin polymerization and labelling I didn't got filaments. Why?

Purified G actin and got 42kda band and an additional band just below it. While performing G actin polymerization and labeling with rhodamine-phalloidin I didn't observe filaments under the...

20 January 2021 3,751 2 View

Why am I seeing multiple bands for beta-actin PCR?

I performed a PCR run on human DNA with the beta-actin primer (F: GCCATCCTGCGTCTGGACCTGGCT; R: GTGATGACCTGGCCGTCAGGCAGC). PCR setting: 98degree 30sec, 30cycle of (98degreeC 10sec, 64degree 30s,...

14 January 2021 6,544 2 View

What is the reason for observing two bands of beta-actin after lipofectamine transfection of keratinocytes cells?

25 December 2020 8,668 3 View

What all factors do we have to consider to interpret cytocompatibility of a nanomaterial from Actin DAPI stained images of HOS cells cultured with it?

Phalloidin stained filaments and dapi stained nucleus

08 December 2020 8,548 3 View

What is the difference between actin and loading control in normalization of western blot???

Regarding normalization of western blot analysis, I have found different strategies people follow but I couldn't understand the principle and which one is the accurate, 1- some refer to loading...

04 December 2020 5,721 8 View

How to quantify cellular B-actin?

Hello community, I have stained my tissue for actin by Phalloidin staining, but now I would like to quantify actin concentrations in my samples. What would be a good method? Thank you!

03 November 2020 3,160 2 View

Dear all! I would like to stain the actin filaments in live cells. Could you recommend me a dye which do not block the actin polymerization?

25 October 2020 4,887 5 View