How to diagnose a bilateral Inferior oblique palsy on the basis of Parkes three step test?

Sana Nadeem @Sana-Nadeem

01 January 1970 0 3K Report

What if there is no hypertropia in a bilateral Inferior oblique palsy?

Can there be equal hypertropia on head tilt to the right and the left?

Badges
Science topic

More Sana Nadeem's questions See All

How can I find the cracked version of ENVI-met software?

Envi-met software

07 August 2024 8,188 1 View

Entropy measure and QSPR modeling in Graph Theor. How to construct the table for lengthy equation?

The entropy measured of molecular graphs plays a crucial rule. The network structures in some cases are very lengthy calculations to handle. Some author avoid to construct table where as most...

30 July 2024 3,126 0 View

Critique Calculaltion in Topological Indices and QSPR Modeling?

The first step is to analyze a 2D molecular graph and implement partitioning techniques to calculate the topological indices. Secondly impose statically tools to generate QSPR model, may or may...

24 July 2024 9,644 1 View

What strategy should be adopted to calculate topological indices efficiently?

Most of the time it is observed that in many manuscripts there are several typo error of topological calculation errors of calculation and partition of edges what ever the type of partitioning it...

22 July 2024 811 0 View

Regarding solubility of Dorsomorphin in DMSO ?

I'm using Dorsomorphin (C24H25N5O) as one component in dual SMAD inhibition of pluripotent stem cells to differentiate into neurons alongwith SB431542. Now as to solubilizing 10mg SB in DMSO for...

11 July 2024 4,832 0 View

To prepare polymethyl methacrylate polymer for the study of acoustic properties without of bubbles during this process, what measures should be taken?

To prepare polymethyl methacrylate polymer for the study of acoustic properties, a mixture of methyl methacrylate monomer and benzoyl peroxide is used. This mixture is then heated and placed on a...

27 June 2024 2,087 1 View

Nicotiana benthamiana seeds sterilization methods for tissue culturing?

I have been trying to grow Nicotiana benthamiana via tissue culture. I used ethanol and sodium hypochlorite with different concentrations and time duration for seeds sterilization and lastly...

18 June 2024 1,756 3 View

As a university teacher, devise effective teaching methods to enhance students' presentation skills?

ABSTRACT The study explored the relationship between mindfulness levels and academic performance among prospective teachers in the subject of Technical Writing and Presentation Skills at the...

14 June 2024 2,867 2 View

If Concentration of DNA is 85ng/ul then calculate its concentration for 50ul reaction using Phusion Flash Master Mix?

can any budy explain how i calculate the DNA concentration for the 50ul reaction?

22 May 2024 9,557 1 View

If the sequence of the primers are given and size of the PCR product is 2500 then what will be the PCR profile for the given reaction?

If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...

22 May 2024 7,777 1 View

Which test should be used to study association among demographic profile and awarness level?

i have to study the awareness and adoption level of cloud computing in a district of India. i also want to use association among demographic variables like gender, age, education, income etc and...

02 August 2024 2,420 3 View

What can i do to find the right topic for my thesis?

i am facing the difficulty to find the right and latest topic for my thesis. i searched and read hundreds of articles but i couldn't find the right one. what can i do I'm really confused.

02 August 2024 1,323 8 View

Do we save MSMEs of the Nation ?

SMEs are backbone of the country's white economy, most of them are II generation entrepreneurs and migrated from family owned business policies, and having sufficient higher educations for...

01 August 2024 5,562 2 View

How to choose the journal?

Hello I want a suitable journal in the field of remote sensing and machine learning to be judged quickly. Thank you for your guidance Thanks

01 August 2024 1,799 4 View

Posthoc test lettering in JAMOVI?

Does anyone know of a module for the JAMOVI software that is capable of generating mean separations using the classic letters based on post hoc results (e.g., Tukey test)? If, as I believe, such...

31 July 2024 3,333 4 View

How to do Mann-Whitney U test with Bonferroni corrected p-values?

Dear All, My lab primarily works on insect wing patterns. In one of the projects, my student and I have defined 19 abnormality characters on the forewing and 6 abnormality characters on the...

31 July 2024 6,464 5 View

If the emission of all greenhouse gases is stopped now, will the temperature of the earth continue to rise?

Here's a serious question: If we were to stop emitting all greenhouse gases right now, would the Earth's temperature start to cool down, or would the existing greenhouse gases continue to warm the...

30 July 2024 5,123 4 View

In terms of chaos, what is the necessary and sufficient condition for authoritarianism, permanent or temporary, to come to exist and persist?

Since 2016 Brexit, the world needed to change the thinking behind traditional democracy as the democratic landscape changed, yet traditional democratic thinkers and actors have been acting as if...

28 July 2024 6,515 1 View

"Idrisi Selva" tutorial Books for pridiction with driving factors in modeling?

Some educational books with practical exercises of the "Idrisi Selva" software, which have step-by-step visual training for predicting the change of land use/land cover and including the use of...

28 July 2024 4,168 0 View

What is effective targeted chaos?

Perfect democracy thinking assumes no chaos so no need for independent rule of law system and liberal democracies assume the possibility of normal democratic chaos that can be sorted out by an...

28 July 2024 473 1 View