Dear Harshraj,

I think GC difference will mostly be significant by giving you big difference in Tm, which is not good for PCR. At any given temperature, you end up with either non-specific binding or no binding in one of the primers, or both. You should check Tm difference for any primer pair, but if you have not done that, calculate it, if too high, you need to redesign at least one of the primers.

Second, high GC can give you G-runs in primers or products. 3 or more Gs in a run may result in intermolecular quadruplexes forming in the PCR mix before or during amplification. Maybe also other problems, like non-specific binding to complementary runs in your template, especially if it is genomic DNA.

If the amplified region is also GC-rich there may be other considerations to take http://www.protocol-online.org/biology-forums/posts/4907.html https://www.researchgate.net/post/GC_rich_PCR_problems

Good luck!

Dear Harshraj,

I think GC difference will mostly be significant by giving you big difference in Tm, which is not good for PCR. At any given temperature, you end up with either non-specific binding or no binding in one of the primers, or both. You should check Tm difference for any primer pair, but if you have not done that, calculate it, if too high, you need to redesign at least one of the primers.

Second, high GC can give you G-runs in primers or products. 3 or more Gs in a run may result in intermolecular quadruplexes forming in the PCR mix before or during amplification. Maybe also other problems, like non-specific binding to complementary runs in your template, especially if it is genomic DNA.

If the amplified region is also GC-rich there may be other considerations to take http://www.protocol-online.org/biology-forums/posts/4907.html https://www.researchgate.net/post/GC_rich_PCR_problems

Good luck!

Hi, GC content can be problematic when it elevates 60% throughout your amplicon. for amplifying GC rich area you need to use specific buffer or enzyme cause regular taq can not work in this region easily. if its possible change the forward primer, its better to  design primers with 45-50% GC. check primers Tm too, if your primers have far different melting temperatures your PCR wont work well.

Hi Harshraj,

The content of your GC in the primers would not be the primary reason for your RT-PCR not working.

There are few steps you have to take to insure for a successful result.

1.       Make sure that your primers are specific by blasting them.

2.       Use  a known housekeeping gene for your DNA to insure the quality of your cDNA and as a positive control.

3.       The annealing temperature of both forward and reverse primers must not differ more than 1 to 2°C.

4.       For best result choose your annealing temperature for your primers around 55°C.

If you provide us with your primer sequences and RT-PCR profile, maybe we can help you further.

Good luck,

Ali

Checking for specificity as Ali recommends is good, however care must be taken that the search does not omit repetitive sequence motifs. BLAST often automatically filters simple repeats or searching may be carried out on a masked genomic sequence, which would not be appropriate for this purpose.

Thank you all for your valuable guidance.

Tm of my F primer is 74 and Tm of R primer is 65 (Here is the sequence F- CATGTGGTACCGCAATGGCGACTCGCCGCCGCTCC, R- TGACCAGCCAAAGACGAAGTCACTAGTGGC) 

1. Quality of C-DNA is ok because in case of  PCR of housekeeping gene it is showing amplification.

My PCR reaction profile is pre denatur 94 for 2 min, denatur 98 for 10 sec, annealing 60  for 30 sec and extension 72 for 45 sec i run total 35 cycle.

Dr. Ali and Dr. Matej please refer this and me further. 

Dear Harshraj,

you have not specified the template DNA material origin. If the PCR was done on human genomic DNA, maybe CCG trinucleotide repeats could cause a lot of unspecific binding for the forward primer. http://neuromuscular.wustl.edu/mother/dnarep.htm#ccg

BLASTN at Ensembl.org finds 9000 (CCG)6 sequences in the human genome.  DiNAMelt server http://unafold.rna.albany.edu//?q=DINAMelt/Two-state-melting predicts Tm 53.2oC for a dimer of your F-primer and a (GGC)6 trinucleotide repeat sequence, for example.

OK, I am sorry sorry, I have not noticed you wrote "cDNA". Since this repeat is supposed to occur in 3'-UTRs what I wrote may still be relevant. Though, not relevant if you are amplifying from cDNA for just one gene.

HI Harshraj,

I am afraid your primers are too long. Specially your F-primer with 74°C is higher than your extension temperature of 72°C . My suggestion would be to shorten your primers, whereby the Tm would be just around 60°C or a bit lower, while trying keep the specificity.

I assume you used the same PCR-profile for your housekeeping gene. What are the primer Tm for those?

Furthermore, how did you design the primers? Did you use any software? If not I would suggest use the following online software:

https://eu.idtdna.com/PrimerQuest/Home/Index?Display=AdvancedParams

With following optimal parameters:

Primer Tm 60°C

Primer GC (%) 50

Primer length 22

Amplicon size between 120-200

At this point you have to Blast the given primers for  their specificity as well.

Good luck,

Ali

Thank you all for your answers. I am going to re design F primer with optimum Tm and GC content . I will update here after getting my experiments with new primers.

Thank you once again 

Hi Harshraj,

I would suggest to do the same for your R primer as well if I were you. Do for both forward and reverse please.

Good  luck,

Ali