I think we may need a little more detail, for instance, how are you digesting?  Is it after gel purification of the product?  or straight after PCR?  You may be losing most of your product after purification if that is what you are doing.  Are you sure your PCR product is correct and has the right cut site in it?  I do not think that your problem is your gel, it is likely a digestion/PCR issue, but it is hard to know without knowing exactly what you are doing. 

I use Asci Enzyme , the PCR product itself without Purification , I confirmed all the pcr product before digestion 

my Restriction enzyme mixture is 7.5 pcr product .5 restriction enzyme , nuclease Free water 14.5 , cut smart buffer 2.5 with total 25ul 

its in a correct direction  

Can you see undigested product on your gel after digestion?  The 40 bp band will be hard to see, but you should see the 220 bp band if the digestion is working correctly.  I would stick to the 2% gel if you want to separate the 260 from 220, you could even do 2.5%, but I still doubt its your gel, its likely a digestion problem.

not all of the PCR product have to be digested its according to the polymorphism , I saw the 220 band clearly but I can not determine if the third band is present or not. 

Artur Burzynski yes that's rights its seems that i misunderstand u  

As I mentioned in your other posted question earlier, the picture in your other question is also upside down. One other indication: at the bottom of the gel usually showed less EtBr (less brightness) [when EtBr is added into the gel] due to the fact that EtBr runs towards the other direction, just like that shown on your gel above.

You can resolve your undigested PCR product and the digested sample on polyacryamide gel. It will provide much better resolution than 2 or 2.5% agarose. you can visualize by EtBr staining.

Hope it works 

My ladder is 50 bp 

Actually I cannot understand what u mean in the upside_dawn . as I ran it on the electrophoresis I viewed under UV and I posted it at the same Direction !!

According to my last Question I loaded the problem samples in the upper line in the gel and added EtBr to the buffer and the bands appear more clearer ..

Artur Burzynski Thanks a lot , I trying to be better 

Artur Burzynski Thanks a lot , I trying to be better 

Hi Rawan,

In terms of the 'norm' of posting a DNA gel image:

No matter what angle you take the picture in the lab, when you publish the gel image in your thesis/dissertation or your paper, the 'norm' is that the 'wells (where you load your DNA samples to run)' of the gel is on the top (see attachment #1). Attachment #2 is an example of a upside-down gel image. [note: images are from websites]

Hi Rawan,

In terms of your digestion results:

I don't know which 50-bp DNA ladder you were using, but there are several commercial available products. From website, I found that at least two of them matched your ladder patterns (the 4th and 10th fragments [count from bottom to top] are brightest), including this one from NEB (https://www.neb.com/products/n3236-50-bp-dna-ladder, see attachment).

I borrowed Artur's picture to check the results, because the bands are clearer.

(1) On the left panel, the band sizes of the un-digested samples are around 250 bp (or ~260 bp) according to the DNA ladder. It matches what you expected. That is a good news.

(2) On the right panel, for the digested samples, there are 2 bands (one is very faint). One is around 150 bp and the other one is around 100 bp according to the DNA ladders. So, the total length is 150 bp + 100 bp = 250 bp (and it matches to the size of un-digested samples).

But, now you get a problem here: the digested bands are 150 bp and 100 bp, not what you pointed out 220 bp and 40 bp. You need to (1) double-check your restriction site location, and (2) have you sequenced the DNA fragment and to make sure that it is suppose to what it is claimed to?

Yuan-Yeu Yau Many thanks for your answer .. 

I did not sequence my DNA fragment , but according to previous researches 

Assaying for this SNP involves producing a fragment of 261bp with 1 cutting site for the restriction enzyme AscI. This cut at position 221 produces 2 fragments (221bp and 40bp) and represents the homozygote genotype (CC). The heterozygote (CA) has 3 bands representing 261bp, 221bp and 40 bp. The enzyme cuts at 5’---G G ↓C G C G C C---3’ or 3’---C C G C G C ↑G G ---5’.

Amplicon (261)

5’CAACGAGGGCGCAGCCGTATGCCCCAGCCCGCTCCGCGGAGCCCCTCACAGCCACCCCCGCCCCGACCGCGCCCCGCGGGCTCGAAGCACCTTCCCAAGGGGCTGGTCCTTGCGCCATAGTCGCGCCGGAGCCTCTGGAGGGACATCAAGGATTTCTCGCTCCTACCAGCCACCCCCAAATTTTTGGGAGGTACCCAAGGGTGCGCGCGTGGCTCCTGGCGCGCCGAGGCCCTCCCTCGAGGCCCCGCGAGGTGCACACT3’

I understand what you were saying, but the fact in front of us is 2 bands with different sizes. This fact cannot be changed. So, probably you should sequence it to verify it, especially the material is from a previous person.

I see. Rawan, after you revealed more info, now I understand your project about. You are trying to use the SNP-created new restriction site (AscI) for PCR product digestion to distinguish the homozygotes (2 bands; both alleles are digested) from the heterozygotes (3 bands, 1 allele will not be cut and 1 allele will be cut into 2 pieces), based on their polymorphism. 

In this case, only the digestion of PCR product you get from a heterozygotes will generate 3 bands. The question is: do you know the samples you used are 'heterozygous' or 'homozygous'? In your question, you said your products are EXPECTED to have 3 bands (260-bp, 220-bp and 40-bp) after digestion. But, look like they have only 2 bands (without the 260-bp band).

No,  actually I don't know if the samples are Homo or heterozygous .. Its my aim to know 

The gel shows an ethidium bromide front. To avoid this load an equal amount of EtBr in the gel as well as in the buffer . This will make the visualization of bands better in the gel.

One thing I might add to the above answers. In PCR of SNP containing product you will get heteroduplex formation of strands from the two species ( normal and polymorphic).

These will not cut but occasionally because they are heteroduplex will run at a larger size than expected so will appear to give an extra band in the heterozygotes.

good luck

paul

Hi Rawan,

Since you have not figured out the right sizes of your digested PCR product, I will use 260 bp, 240 bp and 20 bp as examples to explain:

If A is the allele with SNP (create a AscI) [which can be digested by AscI] and A' without the AscI site (no cut by AscI).

You have 3 possible genotypes for this allele: AA, AA' and A'A'

(1) AA homozygote: PCR will get all A type product, digestion with AscI will produce 2 bands (220 bp + 40 bp)

(2) A'A' homozygote: PCR will get all A' type product, digestion (no cut), so stay only 1 band (260 bp)

(3) AA' heterozygote: PCR will give you these possible products below:

[a] all A type product--digestion with AscI will produce 2 bands (220 bp + 40 bp)

[b] all A' type product--digestion (no cut), will stay 1 band (260 bp)

[c] A+A' type product (heteroduplex, mentioned by Paul) [hybridization of single-stranded A and single-stranded A' during PCR, with a single SNP mismatch]: digestion (no cut), will stay 1 band (260 bp)

Digestion products of [b] and [c] will co-migrate (due to same size, 260 bp) on gel; so, theoretically you will get total 3 bands from heterozygotes.

If everything goes well (good PCR & digestion results), this will be a good set of PCR (with digestion)-based co-dominant markers for the 3 types of genotypes of this specific allele.

Hi Rawan,

For the different sizes (150 bp + 100 bp) of PCR product digestion:

One more thing: since you take over this project from previous people, you also need to verify the primer pairs to see whether they have used other set of primer pairs (see my attached drawing):

For example, primers P1+P2 can give you PCR product which can be digested into 2 fragments of 220 bp + 40 bp. However, if you use P3+P4 primers, resulting PCR product still contain the AscI site, but after digestion, you can get 150 bp + 100 bp fragments. The disadvantage of producing 220 bp + 40 bp bands is that the 40-bp band is small and faint, and with that size it can co-migrate with 'primer-dimer' on a gel. All these make it an un-desirable marker for scoring the genotypes. So, you have to make sure that whether or not the primer set you are using is an 'upgraded' one (for producing a better PCR result), changed by the previous researcher.

Yuan-Yeu Yau  many thanks to u , I checked my primers sequence and found that I use sequence that differ from the sequence mentioned  in the paper that describe the digested product sizes , but the problem that according to the sequence I use  the PCR  product size must be 340 bp not 261 bp , How can explain this ??

1. No, Rawan, without the sequence info of your PCR product, you cannot explain that. So, you need to sequence the PCR product to see WHAT it is. By sequencing, you will know the DNA sequence of the fragment plus the sequences of your primers, and unlock the mystery. Unfortunately, in some cases, a researcher can pick one primer from a set of primers to combine with a primer from another set of primers to make a better PCR result without noting the change in the lab notebook (if they keep one) or only joggle down a few words. This makes it extremely difficult for the people taking over the project to follow. So, you need to check them carefully.

To sequence, you can simply cut out the band, gel-purified it with a kit, and sent for direct sequencing. Sequence both Forward and Reverse strands to obtain primer sequence information. Sequence twice each strand if you wish.

2. In the meantime, you can order the primers described in the paper and use it to verify whether or not you can get the same results as it says on the paper for back up.