I want to perform gateway cloning (from LR reaction onwards) , how could i get the LR sequences to attach them with my sequences in donor and insert. Give me your suggestion, i will be thankful to you.
Dear Rajan,
I would suggest to check the following document it might answer all your questions concerning Gateway Cloning.
https://assets.thermofisher.com/TFS-Assets/LSG/manuals/gatewayman.pdf
We normally use the Gateway Clonase mix II for the actual reaction.
https://www.thermofisher.com/order/catalog/product/11791020?de&en
If you want to get the actual LR sequences or gateway plasmids, you should check out pENTR Vectors.
https://www.thermofisher.com/order/catalog/product/A10462?de&en#/A10462?de&en
The Sequence for attL1 is:
5-CAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCT
The Sequence attL2 is
5-ACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTG
Best,
Jochen
Hi,
Also, you can check about pENTR vectors in 10.1186/1746-4811-4-4. Best wishes.
You can clone a cassette containing AttR sequences, the ccdb gene and the chloramphenicol resistance in your vector after the promoter, making it a destination vector (you have to transform it in E.coli that can cope with the ccdB gene such as DB3) and you also need this vector to have a resistance different from Kana.
Then you can either engineer the AttL sequences flanking your insert (either clone them at each end in the vector where you have the insert or add it to your primers in a PCR reaction). Alternatively you can engineer in, AttB sequences (much shorter) and do a BP reaction with a pDonor generating a pEntry. For this you also need to buy BP clonase.
- Badges
- Science topic
- Similar topics
- Vectorization