If you dont know the sequences, stem loop method will not work. I offer you to ligase an adaptor to your small RNAs than perform cDNA synthesis by adaptor spesific primer. Than you can sequence them all.

 Dear Enes Yağız Akdaş, Thank you for your suggestion. I know the sequence. I also use adapter primer for cDNA synthesis and confirm it successfully. But it is difficult to distinguish different length of small RNA with same sequence.

Thank you 

OK . just a thought or two for PCR.. 

. I am guessing, the sequences are as follows, one end is fixed, the other end varies.  So let's say you have two sequences acacggccgtgtattactgt and acacggccgtgtattactgtGCGAGA.

You use a standard adaptor primer for the left hand end to make cDNA

You then use the same primer as the left hand primer for PCR.

For the right hand end you need two adaptor primers, each with a 10 base adaptor at the 3' end. The adaptors are different. You  see which primer is able to amplify and what the Ct is on the PCR machine

Primer R1, its 3' 10 bases  bind to gtattactgt -- thus will amplify both targets

Primer R2, its 3' 10 bases  bind to ctgtGCGAGA - thus will amplify only the long target.

So if R1 amplifies but R2 doesnt - you have the short RNA

If R1 and R2 both amplify -you have the long RNA.

As well as the primers - you'll need to order two "artificial templates", ie synthetic RNA molecules, to test the system out.

PCR is good for distinguishing between species of molecule - and measuring how much of each is present. I suspect there are already published methods, for doing what you want.

I

. 

do a sRNA northern blot

Dear M. J Brisco , Thank you for your suggestion and nice clarification. It will helpful to me. Thank you once again.

Dear S. Lutzmayer, Thank you for your suggestion. I'll try sRNA northern blot as an alternative method. Thank you

How can a Northern result be used to distinguish different sizes of RNA which are between 20-24 nt?

What did you mean by " it is difficult to distinguish different length of small RNA with same sequence"? (in your later post).  If two RNA with the same sequence, don't they should have the same length?

A northern blot can have single nucleotide resolution.