I have a pair of primer sequences and doubt the band size it shows on the gel. Now I want to calculate the band size with the sequence I have. The problem is I tried to blast the sequence in the primer blast database by applying the "nnnn" technique, but it did not work for me. I tried another database named "UCSC In-Silico PCR," but unfortunately, it did not work for me again. Can anyone help me get rid of these problems with any other better options?
Note: I am looking for genes from bacteria.
If you go to primer blast and enter your forward primer into "use my own forward primer" and then enter the reverse primer as "enter my own reverse primer" and select nr as the database then search you will get an answer like this
product length = 277 Forward primer 1 AGTGGTCTCTGATTCTCCCATCCC 24 Template 76218 .T........C............. 76241 Reverse primer 1 TGTGGGTACCTTTAGATTCAGAAAG 25 Template 76494 ......................... 76470
which gives you the product length or you can subtract 76218 from 76470 and get the same answer. Adding Ns between the primers sounds dubious as computers are very literal and it probably would need the right number of Ns to work
- Badges
- Science method