I am Onur ÖZTÜRK from Turkey, Bursa ULUDAG UNIVERSITY- 3rd years. We are working on a gene therapy for cystic fibrosis. We designed our vector but we can't add the Kozak sequence in it. Can you please help us ? Our gene sequence : >NM_000492.4 Homo sapiens CF transmembrane conductance regulator (CFTR), mRNA
GTAGTAGGTCTTTGGCATTAGGAGCTTGAGCCCAGACGGCCCTAGCAGGGACCCCAGCGCCCGAGAGACCATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTCTCCAAACTTTTTTTCAGCTGGACCAGACCAATTTTGAGGAAAGGATACAGACAG... Thank you, ONUR ÖZTÜRK +90 5350349038
Dear Onur,
The 20 bases near the 1st ATG of the gene you described are as follows: 5'-GAGACCATGCAGAGGTCGCCTCTGGA...
One of the easiest methods is to amplify the sequence downstream from the 1st ATG using primers with the Kozak sequence added.
As follows: Forward: 5'-Kozak-GCCACC-ATGCAGAGGTCGCCTCTGGA-3'
For the reverse primer, use the sequence 20 bases upstream from the termination codon.
Reverse: 5'-ctaaagccttgtatcttgca-3'
On the other hand, it is not clear whether these primer combinations can specifically amplify CFTR from a total RNA-derived cDNA sample of a given cell.
If no amplification is observed, or if non-specific amplification products appear, PCR products amplifying the full length of the cDNA should be prepared using primers that can amplify the full length of the coding region.
Next, it may be a good idea to obtain a PCR product to which the kozak sequence has been added using a primer set containing the aforementioned kozak sequence. Finally, the kozak-PCR product can be cloned into a plasmid vector.
I don't have any information on what kind of cloning vector you are using, so I wonder how reasonable this approach is.
(If you give me the information, we can discuss it.)
On the other hand, for this CFTR gene, there is an ACC sequence before the 1stATG. I think this can function as a kozak, so I feel there is little need to add another kozak.
Best,
Narumi Uno thank you for your respond. We are currently working together on this project. I'm Mert Güngör from Inonu University and I study molecular biology and genetics. As I understand we need to put the Kozak sequence in front of our sequence's starting codon is this right or do we need to add Kozak sequence elsewhere? Another thing I would like to ask is; Is this (GCCACC-ATGCAGA...) the final sequence of our Kozak sequence?
As you may know, The Kozak sequence is considered to be the sequence that defines which of the many ATG sequences is the 1st ATG.Therefore, Kozak sequence means GCCACC just before 1stATG, which is not essential for gene expression, but is required if you want high gene expression level. It is so common that it is required in all artificial gene expression vectors.
Therefore, you should use the following primer sequence to amplify the CFTR gene: 5'-GCCACCATGCAGAGGTCGCCTCTGG-3'.
*This is the sequence I wrote earlier with the hyphen removed.
@Narumi Uno I understand better now. Thank you so much for your replies, best wishes.
- Badges
- Science topic
- Similar topics
- Vectorization