Which anti-his antibody are you using and has it worked well in western blot for other his-tagged proteins?

We had good experiences with the KPL HisDetector™ Western Blot Kit, which uses Nickel instead of an antibody.

The antibody is in good quality. And my positive control worked well in the same membrane...

Even if you run your SDS under denaturing conditions the his-tag might not be accessible enough to be detected by an antibody. You can see if Nickel can bind it or you can try producing your protein with a C-terminal his-tag.

The 3D structure reveals as if N terminus is more accessible for solvent. I tried C terminus as well in the past for another cloning story for the same protein. Although C term was very much less accessible, antibody was detecting it. With this new plasmid and new tag I guess I am having trouble which cannot explain why...

Thank you so much

Hello,

I see two reasons:

1. It may happen that the ATG in front of the His tag is inefficiently used and that most, if not all, translation starts from the ATG of your gene of interest. In this case you would need to determine the N-terminal amino acid sequence (or mass spec). You may also go for another construct where you replace the ATG of your gene of interest (there is no need to keep it anyway) and check if you still get a signal in the Western blot with the protein-specific serum.

2. There could be rapid cleavage of the N-terminal His tag once you break the cells. Strains with knockouts in some protease genes may help but I am not very optimistic about such approach. Maybe better include - if you do not so already - a broad-spectrum protease inhibitor cocktail when you break the cells.

Finally, the codon use (3x CAC, 3x CAT) seems well balanced and should not be a problem for expression in E. coli.

Best wishes,

Ralf

Hello,

For the first option, I should mention that my gene is cloned without its own ATG. So there is just 1 ATG which is before the tag.

For the second option, If it is the case I don't know how to overcome. I am already using BL21(DE3) which should be suitable for such inactivated knockout genes. I also added just PMSF, not a cocktail of some inhibitors..

I have checked the commercially available pet plasmids with his-tag, usually CATCATCATCATCATCATCAC this one. Therefore I hesitated a bit if the tag I added is not suitable..

Thank you.

Hello,

Indeed, I skipped the point that your gene comes without its own ATG. Since you want to purify the protein, do you see an extra band in the Coomassie-stained gel, not just by Western blot?

The EcoRI site introduced codons for glutamic acid and phenylalanine, maybe they interfere with the recognition by the antibody?

Since pET28 vectors encode two His tags, do you have an in-frame fusion with the C-terminal His tag as well or did you introduce the stop codon from your gene of interest? Did you only use NcoI for cloning or did you cleave the vector with a second enzyme?

Best, Ralf

Thank you,

For the first question, I was doing Ponceau staining but there are many bands in total lysate. Sorry maybe I couldn't understand your question...

The cloning was in 2 steps. Because many other restriction enzymes were cutting my gene of interest,I had to add new cut sites. Therefore, First thing to do was cloning of some gene (I used part og GFP). This insert contains primers like that;

Forward: TTTCCATGGGTCATCATCACCACCATCACGAATTCCCAACACTTGTCACTACTT.

Here the first 3 T is for enzyme to sit, CCATGG (NncoI cut site, which exist in the plasmid as well), The 6X his tag, then GAATTC (EcoRI cut site, which doesnt exist in the plasmid, but my gene of interest will be cloned using this enzyme) then part of GFP that will be cloned.

The Reverse primer: TTGCGGCCGCCTCGAGTTATTATTTGTATAGTTCATCC

Here first 2 T is for enzyme to sit, GCGGCCGC (NotI cut site, which exist in the plasmid as well) then CTCGAG (XhoI cut site, which doesnt exist in the plasmid, but my gene of interest will be cloned using this enzyme).

Here the resulting construct is like that:

NcoI cut site (ATG inside it)-GT-Histag-EcoRI-GFP-XhoI-NotI.

After this plasmid, my gene of interest without ATG but WITH TAA stop codon cloned from EcoRI and XhoI. So the new construct is:

NcoI cut site (ATG inside it)-GT-Histag-EcoRI-gene of interest-TAA-XhoI-NotI

So the answer for the last question is, I wanted to tag just N-terminus, so before the tag I included TAA from my gene so that I become sure that the signal I am getting is from N-terminus. But I am getting no signal...

I can also write the exact nucleotide seq here;

TTTTGTTTAACTTTAAGAAGGAGATATACCATGGGTCATCATCACCACCATCACGAATTC-gene of interest-TAA-CTCGAGGCGGCCGC

Key;

TTTTGTTTAACTTTAAGAAGGAGA: RBS

TATA: TATA

CCATGG: NcoI cut site

GT: additional nucleotides

CATCATCACCACCATCAC: His tag

GAATTC: EcoRI cut site

TAA: Stop codon

CTCGAG: XhoI cut site

GCGGCCGC: NotI cut site

I hope you can see something wrong so that I can correct, because I don't know what is the reason really...

For this;

The EcoRI site introduced codons for glutamic acid and phenylalanine, maybe they interfere with the recognition by the antibody?

I don't really know. If it is because of that, it is real unlucky situation then..

Thank you so much!

Hello,

your construction scheme looks OK. Sorry, I cannot give an explanation based on this. My question for total protein staining (Ponceau in your case) was to know if you get strong overexpression of your gene of interest. Since you want to purify the protein, probably via affinity chromatography using the His tag, you should have an expression level (gene induction) that is already visible in total cell extracts, even if you have background from hundreds of other proteins.

Do you know if your protein is in the soluble or insoluble fraction? You can test this by centrifugation after breaking the cells, then load supernatant and resuspended pellet.

Best wishes, Ralf

Hello,

My protein is a membrane bound protein via Ca2+ signalling. I know its solubility is low. Maybe some of them bound to the membrane. However, there was always soluble fraction retaining in the cytoplasm in the case of my old constructs. I always did western with soluble fraction, supernatant part. This time I haven't check but I will check both the supp and the pellet and plus the medium even.

I am seeing little increase with the induction because of this solubility issue (because when I denature it I see lots of good quality induction), however under non-denaturating conditions it is not very good induction. I was hoping to get high yield by increasing the volume of culture.

Thank you.