Hey guys,
In our lab we've been using the Invitrogen branded kit for RT-PCR to use with influenza virus (SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase). But because of how expensive it is we've decided to try out the Biotech Rabbit brand (One Step RT PCR Kit). However, the results aren't that good when using the BiotechRabbit kit due to smears and a wrong product size for one of the reactions.
Invitrogen requires the thermal cycling condition of:
cDNA Synthesis: 50 oC, 30 mins
Denature: 94 oC, 2 mins (40 cycles)
Anneal: 94 oC, 15 sec (40 cycles)
Extend: 50 oC, 30 sec (40 cycles)
Final extension: 68 oC, 1 min
Hold: 4 oC, infinity
With a mixture of:
2X Reaction Mix buffer: 12.5 uL
Reverse Primer: 0.5 uL
Forward Primer: 0.5 uL
DEPC Water: 8.25 uL
Superscript III / TaqMix : 0.25 uL
RNA Template: 3 uL
Total: 25 uL
BiotechRabbit (BTR) requires the thermal cycling condition of:
cDNA synthesis: 50 oC, 20 mins
Initial activation: 95 oC, 2 mins
Denaturation: 95 oC, 10 sec (40 cycles)
Anneal: 55 oC, 10 sec (40 cycles)
Extension: 72 oC, 30 sec (40 cycles)
Final extension: 72 oC, 5 mins
Hold: 4 oC, Infinity
With mixture of:
One Step Mix, 2×: 12.5 uL
RT-RI Blend, 20×: 1.25 uL
Forward Primer: 1 uL
Reverse Primer: 1uL
RNA Template: 0.75 uL
DEPC Water: 8.5 u:
Total: 25 uL
Primers are:
Gene PA1 of Flu B Victoria Lineage:
PA_BVF_1: ACAAAAGGCCAGAAACACAATGG
PA_BVR_1: CATCAGACATTAGAAGAAAGGC
Gene HA1 of Flu A H1n1:
H1MF_1: CAACCGCAAATGCAGACACATTA
H1MR_1: CCAGTAATAGTTCATTCTCCCTTC
------------------------------------
In my first try, I ran B. Victoria lineage of gene segment PA1,
1. Invitrogen kit using above listed thermal cycling condition and mixture
2. BTR using above listed thermal cycling condition and mixture
3. BTR changing cDNA synthesis time from 20mins to 10 mins
4. BTR changing annealing from 55 oC to 50 oC
====> All the band sizes look correct to me, but there is a lot of presence of what I assume to be primer smears? Especially right at the bottom, which the Invitrogen control does not have.
So, in my second try, I reduced the primers for the BTR kit from 1.0 uL to 0.5 uL for the reverse and forward primers and adjusted the DEPC water to have a total of 25 uL. I used the same virus sample but used annealing temp of 50 oC. The product size did not match the previous 4 and had presence of smear above the band not seen to the extent in the previous 4.
I also did the same using a H1N1 sample with an Invitrogen kit control from the HA1 H1N1 Segment to compare with a BTR kit where I changed the primer from 1.0 uL to 0.5 uL and used annealing 50 oC. This time, no smearing, but product size looks (almost?) correct.
So why is the BTR PA1 0.5 uL primer 50 oC annealing different from the BTR H1N1 HA1 0.5 uL primer 50 oC annealing when compared to the control? And is there a way to reduce those smearing below the band?
- The first thing I would say is that you are mixing up your reactions temp and what is going on
- In your first Invitrogen reaction you have initial denaturation cycle of 94oC for 2 min: This is to render everything SINGLE STRANDED to make priming PCR efficient
- You should then have 40 cycles of 94C for 15 sec (denaturation); annealing @ 50C and extension @ 68C
- I point this out not just because of semantics because if you are in effect including 2 x 94C steps, this denatures your duplex DNA but cumulatively also denatures your Taq
- Thus, you might be unnecessarily killing of your Taq with no gain
- For starters do the above (with invitrogen kit)
- This however is not the cause of your problem
- Apart from different reagents the seminal difference between your 2 sets of reactions is that you anneal @ 50C with Invitrogen and 55C with your 2nd kit
- Generally you can set the annealing temp @ tm-2C to Tm-5C for your primers with no adverse effects
- However for some primer/template combinations even a 1C difference in annealing temp can affect how specific your PCR is
- Given that your empirical data from the Invitrogen kit suggests that 50C is better for your primer/target/template combination I would initially try the 2nd kit conditions but anneal @ 50C instead of 55C
- The first thing I would say is that you are mixing up your reactions temp and what is going on
- In your first Invitrogen reaction you have initial denaturation cycle of 94oC for 2 min: This is to render everything SINGLE STRANDED to make priming PCR efficient
- You should then have 40 cycles of 94C for 15 sec (denaturation); annealing @ 50C and extension @ 68C
- I point this out not just because of semantics because if you are in effect including 2 x 94C steps, this denatures your duplex DNA but cumulatively also denatures your Taq
- Thus, you might be unnecessarily killing of your Taq with no gain
- For starters do the above (with invitrogen kit)
- This however is not the cause of your problem
- Apart from different reagents the seminal difference between your 2 sets of reactions is that you anneal @ 50C with Invitrogen and 55C with your 2nd kit
- Generally you can set the annealing temp @ tm-2C to Tm-5C for your primers with no adverse effects
- However for some primer/template combinations even a 1C difference in annealing temp can affect how specific your PCR is
- Given that your empirical data from the Invitrogen kit suggests that 50C is better for your primer/target/template combination I would initially try the 2nd kit conditions but anneal @ 50C instead of 55C
The smear is not connet with the primer but with the concentration of your RNA you add in the beginning.
But how is the final concentration of your primer?
- Badges
- Science method