I am exploring genetic factors in relationship to an outcome after six months, and have identified around 20 SNPs.

I have done the lab work, and now have finished analysing the data. However, some of my data is actually the opposite of what I read in the literature.

So, one SNP is the rs4818. The following is the primer from Thermofisher for use with the Taqman system.

Context Sequence [VIC/FAM]GCCTGCTGTCACCAGGGGCGAGGCT[C/G]ATCACCATCGAGATCAACCCCGACT

If the Ct for VIC (yellow) is much lower than the Ct for FAM (green), would that not make it likely that the sample is from a patient with genotype C/C?

I ask because my results show that the G alelle is more associated with my outcome, however, literature reports that it is the C which is likely to give my effect. I am worried that I might have read my scatterplots wrong.

On the other hand, my distribution of genotypes is similar to other populations, so I am very confused.

This has happened on a number of SNPs of which I could find literature.

Thanks

Stephen