Hello, Is it possible to generate a mice model having combined features of Agt-overexpression, overectomized and breast tumor development?

More Fahmida Akter Rasha's questions See All

How can get paper ?

I need a copy of the research titled “An Efficient Automated Multi-Modal Cyberbullying Detection Using Decision Fusion Classifier on Social Media Platforms" An efficient automated multi-modal...

08 July 2024 7,381 3 View

Has medicine become a trade and not a humanitarian profession, but rather a commercial and investment profession?

25 April 2024 8,681 3 View

Dissolving green-synthesized nanoparticles??

Hi to all, I am trying to dissolve green-synthesized metal oxide nanoparticles for DPPH and ABTS assays. I have tried 70% ethanol and DMSO, but no way. Can any one suggest other solvent(s)? N.B....

08 February 2024 8,357 3 View

What are the latest theories in comparative literature?

I am a PhD student in English Literature

05 February 2024 1,624 4 View

What should be the PCR condition for the OsIRT1 gene of Rice?

The primer sequence is Forward: GGAAGCTTTAGCAAAATCCAGTGTGGTGTA Reverse: AAGGTACCCAAGCTCAATCTAACAATGCAG

31 January 2024 7,077 0 View

What is the maximum percentage of PEG400 we can inject in mice IP?

I have to treat the mice with a drug that is dissolved in DMSO, but to decrease the percentage of DMSO I want to add PEG400 and cyclodextrin. I would like to know the maximum recommended...

17 January 2024 8,543 1 View

Can anyone guide me rgarding the treatment of early embryonic stage of chick embryo?

I will apply a treatment by plant extract to fertilized chicken egg after 12 hrs of incubation. I need to calculate the doses and I want to know is this early embryonc stage can consider as cell...

14 January 2024 9,481 0 View

Do you support that human society must unite and work together to achieve sustainable development, support stability for all countries?

Do you support that human society must unite and work together to achieve sustainable development, support stability for all countries, achieve societal justice, and the duty of the academic and...

04 January 2024 4,431 4 View

How to dissolve vitamin E in PBS and tween 80 for a standard curve?

Vitamin E, being strongly hydrophobic, tends to not dissolve in PBS/ PBS + tween 80/ethanol. Is there any way to solubilize vitamin E in PBS while preparing a standard curve for drug release? And,...

30 December 2023 2,960 4 View

How can researchers optimise the use of statistical analysis tools in quantitative research to improve the reliability and accuracy of their findings?

This question is looking for detailed, actionable advice on leveraging statistical tools in quantitative research to yield more reliable and accurate outcomes.

22 December 2023 1,103 2 View

Is this a facetotecta nauplius?

This larva was captured using a plankton net in the Persian Gulf during the summer. I believe it may be a Facetotecta nauplius.

08 August 2024 3,746 4 View

May members post flyers about opportunities to present at a conference? If so, where to post?

May members post flyers about opportunities to present at a conferehttps://veraeducation.com/nce? If so, where to post for the Virginia Educational Research Association? https://veraeducation.com/

08 August 2024 4,585 1 View

Hello all, Looking for international reviewer to review Ph.D thesis in wireless sensor network.Can anybody help?

My name is Apurva Saoji. I am a Ph.D scholar in Computer engineering in India. I am looking for international expert in reviewing my PhD thesis, "Competitive Optimization Techniques to Minimize...

07 August 2024 4,600 2 View

Research Methodology - Impact of Corporate Reputation on Stakeholders Behaviors?

Please can anyone support with the survey questions based on RQ measures and propose how to do it in FMCG industry and include as well the role of brand equity Thanks

06 August 2024 949 0 View

How to report results of Generalised Linear Mixed Models in a journal article?

Hi everyone, If you have written or come across any papers where Generalised Linear Mixed Models are used to examine intervention (e.g., in mental health) efficacy, could you please share the...

04 August 2024 4,130 4 View

Why results of ROS flurescence are negative as there was no bacteria within?

Hello. I am working on ROS production of two systems: system A is cerium oxide and hydrogen peroxide, system B is cerium oxide nanoparticle, hydrogen peroxide and potassium bromide. I did some...

04 August 2024 5,974 3 View

Radiogenomics Cancer Research Challenges?

what are the top 3 challenges to the advancement of the field of Radiogenomics in cancer research? is it the availability of easily available low-cost matched imaging and biosamples with clinical...

03 August 2024 5,828 4 View

Would you like to join our meta analysis research team?

I am excited to announce an opportunity for dedicated researchers to join our dynamic team for an ongoing meta-analysis study. If you are passionate about research and have a keen interest in...

01 August 2024 6,737 1 View

Is the peer-reviewed publication "MedieKultur: Journal of Media and Communication Research" (E-ISSN 1901-9726, P-ISSN : 0900-9671) a legitima?

Is the peer-reviewed publication "MedieKultur: Journal of Media and Communication Research" (ISSN Online: 1901-9726, ISSN Print: 0900-9671) a legitimate and credible scholarly journal in the field...

01 August 2024 629 3 View

Any tips on how to increase the chances of getting a response?

I've been using ResearchGate for a while now and have found many useful research papers that are beneficial for my work. However, I've noticed that many authors do not respond to my messages....

31 July 2024 7,771 5 View

Rana Jaber Tarish Al-Baghdadi

Hello Fahmida,

I would contact the Jackson lab because they develop many mouse models continuously.

Best wishes

Fahmida Akter Rasha

Thank you

Patrick Aouad

How about generating a xenograft mouse model: NSG mice, overectomized, and intraductally-injected with AGT-overexpressing breast cancer cells?

I am attaching the below paper that may be of relevance to your work and experimental design.

Best,

Patrick