What should be the PCR condition for the OsIRT1 gene of Rice?

Fahmida Anika Khan @Fahmida-Khan-12

01 February 2024 0 7K Report

The primer sequence is

Forward:

GGAAGCTTTAGCAAAATCCAGTGTGGTGTA

Reverse:

AAGGTACCCAAGCTCAATCTAACAATGCAG

Badges
Science topic

More Fahmida Anika Khan's questions See All

Is there an English Translation of the Carl Moller text: ZUR VERGLEICHENDEN ANATOMIE DER SILURIDEN?

I recently came across an anatomy text by Carl Moller that was published in 1915 but it is in German or Dutch neither of which I can understand. I would like to know if there is an English...

10 August 2024 4,347 1 View

What is fitofthora instance of potatoes?

Now research fellow used it to prevent fungus in potato,may be potatoes gene effect.

02 August 2024 180 3 View

What is gangrine? Is there gangrine happened indie potato?

Please discuss someone told about fungus and allied others.

31 July 2024 3,372 3 View

How gold procurement?

Please note it

29 July 2024 4,920 3 View

How gold procurement?

https://www.cleanteqwater.com/resources/case-studies/gold-mine-australia/

29 July 2024 5,161 1 View

What publications should I target as a psychology masters student in the UK?

I am writing a paper as a part of my course. I am new in London and was wondering that what publications should look upto?

21 July 2024 3,538 1 View

I have two problems: 1) the enzyme is not immobilizing efficiently into the MOF material.. 2) the MOF itself has peak on 400nm by using p-NPA test.?

I am working on carbonic anhydrase immobilization into MOFs. I am facing problems with low enzyme loading.. The other issue is that when using p-NPA activity test to detect the activity of the...

20 July 2024 1,440 3 View

Why not cow dung manure used in lie for artificial ?

Cow dung manure is more powerful than artificial fertilizer.

19 July 2024 7,392 7 View

Why not we are following sars COVID 19 guidance?

If the case of Irak is of December 2020 then i think I can suggest pl follow all the infection cause and death, already in our researchgate.

19 July 2024 3,356 2 View

Is cow dung can be in used for repeated use ?

Is this organic cow dung manure now important than artificial fertilizer.if good then why ?

19 July 2024 9,052 2 View

How to confirm the site-directed mutagenesis result without performing NGS?

I'm cloning a fragment of 3200 nts into plasmid. The cloning was successful, however, 02 amino acids were mutated. Now I want to fix these 02 aa by site-directed mutagenesis technique using...

08 August 2024 4,645 2 View

I can't see the ssDNA band after performing asymmetric PCR. Is there any way to do this?

After performing symmetric PCR, PCR purification was performed. Afterwards, asymmetric PCR was performed using the PCR purification product as a template, but no ssDNA band was confirmed in the...

08 August 2024 1,668 3 View

How much total RNA concentration to be extracted from sorted plasma cells from bone marrow of C57BL/6 mice for RT-PCR ?

i have sorted anti-NP specific plasma cells from bone marrow of C57BL/6 mice at certain times after immunization with variable counts and isolated total RNA using TRIZOL method for RT-PCR using...

05 August 2024 8,835 1 View

"A Markov-like Model for Patient Progression"?

A Markov-like Model for Patient Progression" Markov Chain Monte Carlo (MCMC) Markov Chain Monte Carlo (MCMC) is a powerful computational technique used to draw samples from a probability...

05 August 2024 10,079 0 View

Why after performing site directed mutagenesis ,I don't see any colony after transformation?

I want to introduce a point mutation (change in one nucleotide) into my gene of interest (DNA binding domain) I have designed primers as recommended on the Data sheet of the kit : -Both primers...

05 August 2024 9,059 3 View

Anyone having idea about VN primer for miRNA primer design ?

How to design VN primer to attach with universal reverse primer

05 August 2024 2,116 3 View

Why my colony PCR results of my recombinant bacterial not showing any results?

I am performing ligation of the plasmid and a target gene. The steps I have taken are: 1. Double digestion of the plasmid and target gene 2. Ligation of the plasmid with the target gene 3....

05 August 2024 2,570 3 View

Low-yield gel extraction problem?

I am having an issue with my gel image where my PCR product is not appearing very bright on the gel. When I perform gel extraction, the A260/280 purity value is very low. I used the Qiagen gel...

05 August 2024 9,798 3 View

Identify the eight key processes of excellent supply chain management and discuss how each of these processes impacts the end customer?

Read the journal article by Douglas M. Lambert, “The Eight Essential Supply Chain Management Processes,” Supply Chain Management Review, Vol. 8, No. 6 (2004), pp. 18-26

04 August 2024 9,919 4 View

Does atmosphere affect flow of matter & energy on Earth & flow of energy in biosphere related to the flow of food through a food chain?

How does the atmosphere affect the flow of matter and energy on Earth and flow of energy in the biosphere related to the flow of food through a food chain?

02 August 2024 9,644 0 View