The primer sequence is
Forward:
GGAAGCTTTAGCAAAATCCAGTGTGGTGTA
Reverse:
AAGGTACCCAAGCTCAATCTAACAATGCAG
I recently came across an anatomy text by Carl Moller that was published in 1915 but it is in German or Dutch neither of which I can understand. I would like to know if there is an English...
10 August 2024 4,347 1 View
Now research fellow used it to prevent fungus in potato,may be potatoes gene effect.
02 August 2024 180 3 View
Please discuss someone told about fungus and allied others.
31 July 2024 3,372 3 View
Please note it
29 July 2024 4,920 3 View
https://www.cleanteqwater.com/resources/case-studies/gold-mine-australia/
29 July 2024 5,161 1 View
I am writing a paper as a part of my course. I am new in London and was wondering that what publications should look upto?
21 July 2024 3,538 1 View
I am working on carbonic anhydrase immobilization into MOFs. I am facing problems with low enzyme loading.. The other issue is that when using p-NPA activity test to detect the activity of the...
20 July 2024 1,440 3 View
Cow dung manure is more powerful than artificial fertilizer.
19 July 2024 7,392 7 View
If the case of Irak is of December 2020 then i think I can suggest pl follow all the infection cause and death, already in our researchgate.
19 July 2024 3,356 2 View
Is this organic cow dung manure now important than artificial fertilizer.if good then why ?
19 July 2024 9,052 2 View
I'm cloning a fragment of 3200 nts into plasmid. The cloning was successful, however, 02 amino acids were mutated. Now I want to fix these 02 aa by site-directed mutagenesis technique using...
08 August 2024 4,645 2 View
After performing symmetric PCR, PCR purification was performed. Afterwards, asymmetric PCR was performed using the PCR purification product as a template, but no ssDNA band was confirmed in the...
08 August 2024 1,668 3 View
i have sorted anti-NP specific plasma cells from bone marrow of C57BL/6 mice at certain times after immunization with variable counts and isolated total RNA using TRIZOL method for RT-PCR using...
05 August 2024 8,835 1 View
A Markov-like Model for Patient Progression" Markov Chain Monte Carlo (MCMC) Markov Chain Monte Carlo (MCMC) is a powerful computational technique used to draw samples from a probability...
05 August 2024 10,079 0 View
I want to introduce a point mutation (change in one nucleotide) into my gene of interest (DNA binding domain) I have designed primers as recommended on the Data sheet of the kit : -Both primers...
05 August 2024 9,059 3 View
How to design VN primer to attach with universal reverse primer
05 August 2024 2,116 3 View
I am performing ligation of the plasmid and a target gene. The steps I have taken are: 1. Double digestion of the plasmid and target gene 2. Ligation of the plasmid with the target gene 3....
05 August 2024 2,570 3 View
I am having an issue with my gel image where my PCR product is not appearing very bright on the gel. When I perform gel extraction, the A260/280 purity value is very low. I used the Qiagen gel...
05 August 2024 9,798 3 View
Read the journal article by Douglas M. Lambert, “The Eight Essential Supply Chain Management Processes,” Supply Chain Management Review, Vol. 8, No. 6 (2004), pp. 18-26
04 August 2024 9,919 4 View
How does the atmosphere affect the flow of matter and energy on Earth and flow of energy in the biosphere related to the flow of food through a food chain?
02 August 2024 9,644 0 View