The primer sequence is
Forward:
GGAAGCTTTAGCAAAATCCAGTGTGGTGTA
Reverse:
AAGGTACCCAAGCTCAATCTAACAATGCAG
Working on chandrayaan-2 DFSAR data, there are three datasets available: 1) Slant range image data product: The slant range complex image file. Each pixel is represented by two 4-byte floating...
02 March 2021 8,481 3 View
Actually, I am running cfd simulation for a heat exchanger which has two fluids one hot and other one is cold fluid. there is a solid domain between them, which I removed and instead I have used...
01 March 2021 9,537 2 View
I am simulating Heat Exchanger. I have tried and tested all the methods to resolve this issue from the internet like refining mesh, improving skewness and orthogonal quality ,extending outlet to...
01 March 2021 6,985 3 View
01 March 2021 1,290 2 View
Should I mesh the solid domain ? or should I use wall thickness? or Shell conduction? for Heat Transfer between two fluids of a Heat Exchanger. what is recommended?
01 March 2021 9,785 3 View
I have a virtual machine. My host Pc specs are not that good thats why i went for virtual servers. so basically my host pc has 8gb of ram with nvidia quadro k2200 4Gb DDR5 GPU ,processor intel...
01 March 2021 8,415 1 View
I have a doubt on how to select the inductor and capacitor value when I want to implement MPPT controller. This is because we always take a maximum output voltage and current but in this case, we...
28 February 2021 3,637 2 View
Hello everyone, I have some PHAs blended with fillers and nucleating agents, yet I don't know what kind of fillers or nucleating agents. The producer has shut down and there's no way to get in...
24 February 2021 1,356 8 View
Hello, We are planning on staining Formalin-fixed paraffin breast cancer tissue sections (FFPE) with CD8 Ab via immunofluorescence (Tissue IF). Based on our existing protocol and imaging...
24 February 2021 9,578 4 View
Suggest me the method or some other software to calculate the above said data for nanoparticles.
21 February 2021 3,350 7 View
I have a dataset with about 80 different species. As usual, some species are very easy to identify with certainty whereas others are more difficult, which means that I am less certain of my...
03 March 2021 8,066 4 View
Hello, We would like to increase the yield of our PCR product. We are running a series of PCR reactions that is targeting ~1.1kb sequence. We begin each reaction with ~400pg of template DNA...
02 March 2021 4,029 3 View
Hi, I am planning to apply for the PhD degree in the Supply Chain Mgt. with specific area of "Cold Storage warehouses" during Pandemics and wars. Where lock downs and shut downs are frequent....
02 March 2021 285 2 View
So, I have been trying to run a pACYC PCR which will be used later on for a Gibson Assembly. However the PCR is not working. I have already tried gradient PCR and changing extension time; however...
02 March 2021 1,146 2 View
I am going to have 3 different probes in my qPCR work that I am going to do. But I realized that the machine we have in the lab is a Rotor-Gene Q 2plex HRM Platform, saying it has green, yellow,...
01 March 2021 8,544 1 View
I have to amplify a gene and my primers just reached. The Tm for Forward primer is 64.2, and that of reverse primer is 65.5. Can some one suggest how to get the best annealing temperature? Thanks...
01 March 2021 360 7 View
To dear Researchers, I was analyzing a series of concentration for estimation of Real-Time PCR efficiency. The concentration was 1:10. I used MS-excel to evaluate Slope. The result of slope was -8...
01 March 2021 8,683 4 View
Does anyone have the experience of using Taq Man probes in the QIAGEN Rotar- Gene qPCR machine?
01 March 2021 5,311 1 View
I am trying to identify these 3 genes among some tomato cultivar collections and after aligning some sequences from NCBI, I couldn't find unique sequences to target for specific primers. There...
28 February 2021 606 3 View
hello everyone, I need to do standard curves for my qPCR, what is the ideal efficiency range? I tried a primer (Mglu2 receptor) that gave an efficiency of 90.2%. Is it accepted?
28 February 2021 1,254 3 View