I am looking for PCR primers for bacillus Sp.
https://patents.google.com/patent/CN102226216B/en
Hello, look for universal primer for bacillus by google.
Karen A. Darbinyan I did, but couldn't find anything.
Hello, use
B27f (5'-AGAGTTTGATCCTGGCTCAG-3') and
U1492R (5'- GGTTACCTTGTTACGACTT-3')
as universal bacterial primer for positive amplification approval and
use below bacillus specific primer
463 F (5’CTAAAACTCAAAGGAATTGACG3’) and 463R (5’AATACGTTCCCGGGCCTT3’).
for bacilli detection.
Good luck!
Karen A. Darbinyan Thank you very much!
during ultrasound examination of acute abdomen, sometimes we see free fluid , can we know the type of fluid ,whether blood or not , using ultrasound only? if yes , what are the sonographic...
01 March 2021 7,476 4 View
Is the period to autoclave not enough? The inoculation in a hood and flame and UV and alcohol.
27 February 2021 9,356 3 View
I need to be able to match in-text citations to a reference list and back again in very large documents (100+ pages) WITHOUT the use of referencing software like Endnote. my method is to type the...
27 February 2021 9,848 1 View
I want to publish paper in journal but I have figures which have drawn with bio-renders, can I put them in the paper or which other software I can use to draw them?
27 February 2021 8,179 1 View
What is the most suitable medium of ascomycetes fungi ??
26 February 2021 4,413 1 View
Using GDB, it is straightforward to debug and monitor a target program by setting a break-point at a specific instruction, since the instruction addresses are known. However, we have two...
24 February 2021 1,598 2 View
Hi everyone, I am just wondering if we incubated 200 microliter of whole blood with 50 microliter of cancer cells(1bout 5000cells) do you think that cancer would survive for 48 hours?
23 February 2021 3,840 3 View
Detecting the drug related problems is an important step in the pharmaceutical care plan
21 February 2021 5,421 3 View
We have a research project consisting of three variables where big data is the independent variable. Some previous studies showed that Volume, Variety, Velocity and Veracity Are the dimensions...
21 February 2021 8,133 2 View
Pico-scale This is three orders of magnitude smaller than a nanometer (and thus most nanotechnology) and two orders of magnitude smaller than most chemistry transformations and measurements. Pico...
18 February 2021 4,540 5 View
I have a dataset with about 80 different species. As usual, some species are very easy to identify with certainty whereas others are more difficult, which means that I am less certain of my...
03 March 2021 8,066 4 View
Hello, We would like to increase the yield of our PCR product. We are running a series of PCR reactions that is targeting ~1.1kb sequence. We begin each reaction with ~400pg of template DNA...
02 March 2021 4,029 3 View
Hi, I am planning to apply for the PhD degree in the Supply Chain Mgt. with specific area of "Cold Storage warehouses" during Pandemics and wars. Where lock downs and shut downs are frequent....
02 March 2021 285 2 View
So, I have been trying to run a pACYC PCR which will be used later on for a Gibson Assembly. However the PCR is not working. I have already tried gradient PCR and changing extension time; however...
02 March 2021 1,146 2 View
I am going to have 3 different probes in my qPCR work that I am going to do. But I realized that the machine we have in the lab is a Rotor-Gene Q 2plex HRM Platform, saying it has green, yellow,...
01 March 2021 8,544 1 View
I have to amplify a gene and my primers just reached. The Tm for Forward primer is 64.2, and that of reverse primer is 65.5. Can some one suggest how to get the best annealing temperature? Thanks...
01 March 2021 360 7 View
To dear Researchers, I was analyzing a series of concentration for estimation of Real-Time PCR efficiency. The concentration was 1:10. I used MS-excel to evaluate Slope. The result of slope was -8...
01 March 2021 8,683 4 View
Does anyone have the experience of using Taq Man probes in the QIAGEN Rotar- Gene qPCR machine?
01 March 2021 5,311 1 View
I am trying to identify these 3 genes among some tomato cultivar collections and after aligning some sequences from NCBI, I couldn't find unique sequences to target for specific primers. There...
28 February 2021 606 3 View
hello everyone, I need to do standard curves for my qPCR, what is the ideal efficiency range? I tried a primer (Mglu2 receptor) that gave an efficiency of 90.2%. Is it accepted?
28 February 2021 1,254 3 View