I am looking for PCR primers for bacillus Sp.
https://patents.google.com/patent/CN102226216B/en
Hello, look for universal primer for bacillus by google.
Karen A. Darbinyan I did, but couldn't find anything.
Hello, use
B27f (5'-AGAGTTTGATCCTGGCTCAG-3') and
U1492R (5'- GGTTACCTTGTTACGACTT-3')
as universal bacterial primer for positive amplification approval and
use below bacillus specific primer
463 F (5’CTAAAACTCAAAGGAATTGACG3’) and 463R (5’AATACGTTCCCGGGCCTT3’).
for bacilli detection.
Good luck!
Karen A. Darbinyan Thank you very much!
Air moisture harvesting Air water collection devices
06 August 2024 5,473 2 View
Hi everyone I need a file with a dirty and clean potato image
04 August 2024 7,199 4 View
Molecular docking software/ websites?
02 August 2024 8,704 7 View
Can we patent a process flow diagram developed using a process simulator but no actual cases is carried out? For example consider a process for certain product manufacture where a new process flow...
31 July 2024 781 1 View
I am working on algal extract to which gas chromatography (Not GC-MS) spectrum I want to discover. My question is can we identify specific compounds using retention time if I compared the RT with...
29 July 2024 8,034 4 View
I want to write a topic for my PhD thesis in hospitality (hotels), can u please suggest some variables
29 July 2024 9,058 3 View
Time-Frequency Domain
19 July 2024 8,031 2 View
Dear Colleagues, I hope this message finds you well. My name is Noor Al-Huda K. Hussein,and I am a researcher specializing in deep learning applications in genetic data analysis. I am currently...
18 July 2024 5,562 0 View
Dear Colleagues, I hope this message finds you well. My name is Noor Al-Huda K. Hussein, and I am a researcher specializing in deep learning applications in genetic data analysis. I am currently...
16 July 2024 3,981 6 View
I am currently testing the effect of bacterial filtrates on cancer cells , after seeding the cells I tested the bacterial filtrates against them , and got images of all 96 wells using inverted...
10 July 2024 7,145 2 View
I'm cloning a fragment of 3200 nts into plasmid. The cloning was successful, however, 02 amino acids were mutated. Now I want to fix these 02 aa by site-directed mutagenesis technique using...
08 August 2024 4,645 2 View
After performing symmetric PCR, PCR purification was performed. Afterwards, asymmetric PCR was performed using the PCR purification product as a template, but no ssDNA band was confirmed in the...
08 August 2024 1,668 3 View
i have sorted anti-NP specific plasma cells from bone marrow of C57BL/6 mice at certain times after immunization with variable counts and isolated total RNA using TRIZOL method for RT-PCR using...
05 August 2024 8,835 1 View
A Markov-like Model for Patient Progression" Markov Chain Monte Carlo (MCMC) Markov Chain Monte Carlo (MCMC) is a powerful computational technique used to draw samples from a probability...
05 August 2024 10,079 0 View
I want to introduce a point mutation (change in one nucleotide) into my gene of interest (DNA binding domain) I have designed primers as recommended on the Data sheet of the kit : -Both primers...
05 August 2024 9,059 3 View
How to design VN primer to attach with universal reverse primer
05 August 2024 2,116 3 View
I am performing ligation of the plasmid and a target gene. The steps I have taken are: 1. Double digestion of the plasmid and target gene 2. Ligation of the plasmid with the target gene 3....
05 August 2024 2,570 3 View
I am having an issue with my gel image where my PCR product is not appearing very bright on the gel. When I perform gel extraction, the A260/280 purity value is very low. I used the Qiagen gel...
05 August 2024 9,798 3 View
Read the journal article by Douglas M. Lambert, “The Eight Essential Supply Chain Management Processes,” Supply Chain Management Review, Vol. 8, No. 6 (2004), pp. 18-26
04 August 2024 9,919 4 View
How does the atmosphere affect the flow of matter and energy on Earth and flow of energy in the biosphere related to the flow of food through a food chain?
02 August 2024 9,644 0 View