01 January 1970 2 9K Report

I would enjoy think tanking with you if I have peaked your interest.

Dennis (Dr Sha) (Dennis Shavelson DPM)

More Dennis Shavelson's questions See All
How to carry out micro preparation of Zn-2 (Zamak 2) sample surfaces?

I am currently struggling to achieve a good surface finish on mounted Zn-2 samples. Both grinding and polishing (with SiC, silica and diamond) resulted in embedding of the grinding/polishing media...

11 June 2024 2,055 0 View

FFPE mouse femurs appear to have internal bubbles?

I am wondering if this is a technical issue that occured during processing. I have murine femurs that were decalcified in 15% EDTA over 2 weeks and then processed and I embedded them into FFPE....

02 April 2024 6,382 2 View

Is it necessary to include an FMO for 7-AAD dye in your Flow Cytometry experiment? If not, why?

I'm optimizing a flow cytometer experiment and one of my three stains is a 7-AAD Live/Dead stain. The other stains in my experiment are staining for CD34+ and CD45+ cells. Is it necessary to...

01 April 2024 3,060 0 View

What is best way to get lowest adsorption site at subsurface of high entropy alloys?

I am currently studying diffusion of oxygen in high entropy alloys. I want to calculate the activation energy from an adsorption site on the surface to the subsurface. I placed the oxygen atom...

26 March 2024 3,268 0 View

Examples of gender norms that affect men and women's participation in agriculture?

It is a course unit called gender and social economic issues in development ARX 1201

07 January 2024 365 0 View

Is it necessary to to conduct independent simple regressions for a multivariate regression model or this can be derived from the multiple regres?

The objective here is to determine factor sensitivities or slope coefficients in a multiple ols regression model.

17 August 2023 7,825 5 View

Does anyone had problems installing Cytoscape in Ubuntu 22.04.2 LTS?

I am trying to install Cytoscape in Ubuntu 22.04. I followed the instructions on the official website and installed Java 11, 17 and 18. None seems to work. I had this error every time: Error:...

30 May 2023 9,889 2 View

Why is it that when I open a structure and I select atoms in Vesta it crashes immediately?

I am trying to work on a structure in Vesta. But after opening, it crashes when I select atoms to delete. Any help would be deeply appreciated

07 March 2023 5,805 4 View

Working primers for human NPC1 and TrkB qPCR?

For one of our experiments we are planning to run a qPCR on cDNA from human samples. In our first test, we found that our primers for TrkB (forward: ACAGTCAGCTCAAGCCAGACAC, reverse:...

24 January 2023 4,508 3 View

Can standardize test be a data collection tools for descriptive study?

Good day scholars, I am doing a descriptive study and want to administer a standardize test, is it possible?

21 September 2022 6,517 1 View

Similar questions and discussions
Do you think can be any diamond in A type eclogites?

I want to know more about diamond ore deposits in world.

08 August 2024 1,514 0 View

U you think We need a website software of Blackbody radiation law expert software?

A website software of Blackbody radiation law expert software can used through the following web site. http://39.105.188.151:3000/index

07 August 2024 1,706 0 View

Enhancing Critical Thinking Skills for Slow Learners: A Review of Empirical Studies?

to identify themes in question with APA style references

07 August 2024 2,239 5 View

Are there any good simple systems or platforms to recommend?

In order to show people the beauty of control and enhance enthusiasm for learning control theories, are there any good simple systems or platforms to recommend?

05 August 2024 10,034 1 View

How to preform densitometry on SDS-page bands?

I ran a SDS-page of a bacterial lysate and I want to quantify protein concentration in a specific band. I was thinking of using a standards ladder or make some standards are different...

05 August 2024 9,805 3 View

Do you think can be any gas and oil bearing rocks in Eastern part of Iran?

I want to know more about petroleum deposits in Iran.

02 August 2024 8,725 3 View

Senescence-associated beta galactosidase staining is False Positive in control group?

Hi guys If anyone is currently working on aging cells, you guys would like to give me some advice. I'm testing against biomarker (SA-beta-Gal), I encountered a false positive in the control group...

02 August 2024 6,735 1 View

Are current regulations effective in preventing cancer caused by toxins?

I am currently researching the impact of environmental toxins on children's health and would greatly appreciate insights from experts in the field. If you are an expert or researcher working on...

02 August 2024 4,474 2 View

What is the best sampling strategy?

I am conducting a qualitative study that uses interviews to investigate the perceptions of teachers about a particular leadership practice and I am focusing on 3 schools which have a total number...

01 August 2024 8,457 10 View

Would you like to join our meta analysis research team?

I am excited to announce an opportunity for dedicated researchers to join our dynamic team for an ongoing meta-analysis study. If you are passionate about research and have a keen interest in...

01 August 2024 6,737 1 View

Our partners will collect data and use cookies for ad personalization and measurement. Learn how we and our ad partner Google, collect and use data. Agree & close