my oligo forward: 5`->3`:CACCGCTAGACACGGAATCATGCCG
reverse 5`->3`:AAACCGGCATGATTCCGTGTCTAGC
I done all things stickily followed the zhanglab protocol-Target Guide Sequence Cloning Protocol, digest vector run gel and get two band ,the small one is about 2kb，Gel purify the large one at a concentration 39.4ng/ul total 30ul of 5ug vector，260/280=1.92，260/230=1.42，phosphorylate anneal my oligos ,dilute annealed oligos 1:200, ligation reaction as the protocol indicated, transform 5ul of ligation production into 50ul stbl3 cell, grow in 30℃ for 20hours,each plate have about 15 colonies , then pick 8 of them for sanger sequence, none of them are correct,have anybody meet the same situation , which steps maybe wrong? any suggestion for me ,thankyou ! files are my sequence result ,lenticrispr v2 are the same as addgene show
Make sure you restriction enzyme is working properly. You can try to transform your bacteria with your linearized plasmids (after gel purification and before ligation). In this case you should see no colonies on your agar plate.
You can repeat this after the ligation step without your annealed oligos added to the tube and theoretically you should see no or very few colonies again.
On the other hand, you can (must) perform a colony PCR before having any sequencing.
You can also redigest your cloned vectors.
Have more questions?
Thankyou Mohamad Pirouzfar, After a another try with my linear plasmid as a negative control, ligation plate have about 15 colonies and negative have no obvious visible colonies, I pick all of then for PCR colony ,only three of them have PCR production, then sequence ,result showed correctly insert into lenticrispr v2 vector. I think maybe the T4 DNA ligase is not as effectively as the manufactory instruction show, longer timefor ligation reaction may better.
Most likely your problem is with the T4. Optimizing a ligation reaction with a certain ligation set (the enzyme, the backbone, the insert and the buffers) is essential. Try various incubation times (1 hour to overnight) in different temperatures (4, 16 and RT).
- Badges
- Science topic
- Similar topics
- Physical Sciences
- Materials Science
- Plating