4 Questions 13 Answers 0 Followers
Questions related from Liao Liping
my oligo forward: 5`->3`:CACCGCTAGACACGGAATCATGCCG reverse 5`->3`:AAACCGGCATGATTCCGTGTCTAGC I done all things stickily followed the zhanglab protocol-Target Guide Sequence Cloning Protocol,...
29 December 2018 4,814 3 View
I want to knock out gene by cas9 protein in RAW 264.7 cell, One of the essential factors is to transfected enough cas9 protein and gRNA complex (RNP) to the cell, thus electrophoresis may be a...
01 January 1970 8,832 5 View
My protein have an Tm of 65℃ after elution with 200mM imidazole ,concentration is 0.2mg/ml,Then I concentrated protein by Millipore 30K ultrafiltration tube to an concentration to 2mg/ml, then I...
01 January 1970 3,326 7 View
I alwasy use Ni-NTA to purify 6xHis-tag protein,my buffer usually is netural PH with low beta-ME (1mM-4mM)or NO reducing agent , after one time use the column fade and alway become little yellow...
01 January 1970 2,376 5 View