Liao Liping

4 Questions 12 Answers 0 Followers

Questions related from Liao Liping

Have problems in insert sgRNA into lenticrispr v2 vector?

my oligo forward: 5`->3`:CACCGCTAGACACGGAATCATGCCG reverse 5`->3`:AAACCGGCATGATTCCGTGTCTAGC I done all things stickily followed the zhanglab protocol-Target Guide Sequence Cloning Protocol,...

29 December 2018 4,721 3 View

Does the lonza Nucleofector kit capable of cas9 protein+gRNA RNP electrophoresis

I want to knock out gene by cas9 protein in RAW 264.7 cell, One of the essential factors is to transfected enough cas9 protein and gRNA complex (RNP) to the cell, thus electrophoresis may be a...

01 January 1970 8,765 5 View

Did anyone have meet some protein which is denature and aggregrate when concentrated by ultrafiltration tube millipore

My protein have an Tm of 65℃ after elution with 200mM imidazole ，concentration is 0.2mg/ml,Then I concentrated protein by Millipore 30K ultrafiltration tube to an concentration to 2mg/ml, then I...

01 January 1970 3,260 7 View

Why does my nickel column fade after I use it and cannot become blue as new

I alwasy use Ni-NTA to purify 6xHis-tag protein,my buffer usually is netural PH with low beta-ME (1mM-4mM)or NO reducing agent , after one time use the column fade and alway become little yellow...

01 January 1970 2,286 5 View