3 Questions 1 Answers 0 Followers
Questions related from Nadia Cipta
I have obtained a forward sgRNA sequence through sgRNA design tool as follows: TCCCCAATCTGGGCGCGCGC As far as I know, it will bind to the antisense strand right before NGG (PAM). However,...
08 June 2020 7,938 0 View
Hello everyone, what are some ideas for developing cheaper test kits (it can be PCR-based or others) for COVID-19 diagnostics? For those experienced in such test kits development, what would be...
02 June 2020 3,359 6 View
Dear all, I'm looking for publicly available Esrrb immunoprecipitation-mass spectrometry (IP-MS) data performed in mouse embryonic stem cells grown in serum condition. Would appreciate if...
01 January 1970 9,085 3 View