On the internet, there are many version of 35S promoter sequences. I have a transgenic plants and know there is a 35S promoter driving the expression of a gene, but I do not know the exact sequence of the 35S promoter. Does anybody know the common/core primers to genotype 35S promoter? Many thanks.
35S (F): 5' ACGCACAATCCCACTATCCTTC 3' Tm: 59 C
You can change the length from 3' end according to the Tm of your Reverse Primer
Hi Peijin,
There is an 'enhancer element' in the original 35S promoter. Later, different versions of 35S promoter were developed-- with some harbor two enhancer (or therefore, 'double enhancer') and some still have one enhancer. Enhancer increases promoter activity. I believe the enhancer(s) is/are preserved in current 35S promoters. In our lab, we used double-enhancer 35S promoter to boost transgene expression. If you HAVE TO use a pair of common/Core primers, you may probably try to PCR this enhancer, but the PCR size is kind of small (between 100-200 bp).
You may also try to design one primer within the enhancer and one primer outside the enhancer (or the gene-of-interest next to it.) to obtain a specific band. You can sequence the band and BLAST it to find out what version is your 35S promoter belongs to.
Good luck,
- Badges
- Science method