I am experiencing some issues in successfully genotyping some adiponectin KO mice. The KO band comes out properly but the WT one doesn’t come out anymore. I have tried various corrections (gradient, dmso, clean prep vs dirty prep, incresed cycling) but nothing seems to work anymore. The primers for the WT reaction are: F: TTGGACCCCTGAACTTGCTTCACACC and R:TCCTGAGTTCAATTCCCAGCACCCAC (they both sit before the gene). I am using a hotstart Taq form Qiagen and preferentially make dirty preps.The mice have a neomycine cassette disrupting the gene sequence as in Nawrocki et al , JBC 2006. Current PCR program: 95C 5', 95C 15'', 62C 30'', 72C 30'', 72C 3' (35 cycles). Someone has any clue to help me? Thank you!