I am trying to quantitatively analyze C. paraputrificum from rat small intestine. Does anyone worked with this set of primers? - ClPar-1 TGACATCTCCTGAATTACCA and ClPar-2 TACAATCCGAACTGAGACC (Tonooka et al. 2005).
The problem is that when the qPCR products are run on agarose gel some of the samples appear with two bands, one at 300 and another at 500 bp.
Thank you in advance.
Did you isolate the bacteria from the rat intestine and subjected to PCR? which is the source of your DNA? because if you used the rat intestine having bacteria within, you might amplify something from the rat genome with CIPar-1 and several other bacterial species (such as Paenibacillus) with the reverse. Just an idea
Thank you for your reply. Yes, I amplified before and also performed a Denaturant Gradient Gel Electrophoresis prescreening. I thought maybe someone else has used this set of primers.
- Badges
- Science method