Can use the same vector for overexpression and transient expression?

More Hafiz Muhammad Rizwan's questions See All

I'm interested to quantify Urea by HPLC method, reversed phase conditions are preferable. Is there a good method suited for urea?

I have to develop a method that can be good enough to run dozens of samples that include urea as the main compound. I prefer an HPLC method because of the convenience of running large numbers of...

01 February 2021 1,888 4 View

How to convert ng/ul of DNA concentration to pmol/ul ?

Dear researcher, After amplifying my target gene (1900bp) into the required cDNA by PCR,>cut specific gel bands and purify the gel and the concentration was 30ng/ul. Next, performed A-Tailing...

21 January 2021 2,671 3 View

Can use Unigenes from RNA sequences for overexpression studies (transformation) without requiring a specific plant genome?

Dear researchers: If the plant genome has not been released yet, can Unigenes from RNA sequences be used after BLAST and confirmed with known Arabidopsis genes for function/overexpression...

20 January 2021 5,557 2 View

What is the reason of weight gain in TGA curve of a HDPE polymer sample ?

HDPE samples were aged at higher temperatures in the presence of water and CO2 than the TGA test was performed in Nitrogen? Weight gain is seen in the curve? What could be the possible reason for...

16 January 2021 5,644 2 View

Can BLAST/ search by using known Domain in Transcriptome/Genome data for a gene family?

Dear Researchers, I have Transcriptome/Genome data and want to list all the member of a KCS/CER gene family whose Domain AP2/ERF, FAE1_CUT1, according to the Arabidopsis database, so is there...

15 January 2021 2,293 3 View

Is it necessary to measure the concentration of PCR/Gel purified product for A-tailing and TA cloning?

Dear Researchers, While working on plant gene transformation, so after cDNA + Gene Primer amplification, >the PCR/Gel were purified, so next for A-tailing and TA cloning is mandatory to...

12 January 2021 3,272 34 View

Why negative controls also showing the specific bands of promotor and other regions (GUS, GFP etc.)?

Dear Researchers, I did a transformation of an empty vector (pCAMBIA1301/1302) into my passion fruit plants, for the optimization of the transformation protocol. After transformation; DNA...

06 January 2021 8,465 99 View

Can anybody help me out in TRNSYS about short term thermal energy storage used as buffer storage ..?

i am a beginner in trnsys and need help ... can anyone please guide me

20 December 2020 1,040 3 View

Smear in PCR product after purification, how to get rid of it?

I've done a PCR using primers Forward: CGCCATCAAGGTACCAGTTGA and Reverse: CAGGCTCAGGTACAGCTGGTGG AGTCTGG saw a band at around 400bp and purified my PCR product using QIAquick PCR Purification...

28 November 2020 1,701 7 View

Precipitation based BIAS CORRECTION Method ?

What are the different methods of correction for precipitation bias? How can we evaluate which particular bias correction methods perform the best for a specific watershed? You are asked to...

17 October 2020 966 2 View

MD MOE RMSD

How to calculate the RMSD values for a MD simulation using MOE?

07 August 2021 0 0 View

MD MOE RMSD

How to calculate the RMSD values for a MD simulation using MOE?

07 August 2021 0 0 View

fatal error

When I tried to energy minimization my system, I got fatal error as below. Fatal error: Atomtype opls_116 not found Although I've already added this line: ; include water #include "oplsaa.ff/spc.itp" to [molecultype] directive in my topology.

16 June 2021 0 0 View

fatal error

16 June 2021 0 0 View

fatal error

16 June 2021 0 0 View

fatal error

16 June 2021 0 0 View

Binary Logistic Generalized Linear Mixed model in SPSS. Is it doable?

I want to analyses the proportion of swimming sperm of three species of fish in two salinities. To analyse the proportion of swimming sperm in a Generalized Linear Model, I would use a Binary...

03 March 2021 2,297 3 View

What kind of fluid could I use for a pitfall trap that also does not invalidate molecular testing?

Hi, I want to start testing pitfall trap to obtain ants samples, but I need to conduct molecular analysis on those insects. So, what kind of fluid can I use? Ethanol expires too early and I need...

03 March 2021 5,978 5 View

Can linear DNA be used as template for site-directed mutagenesis?

Is it possible to induce site-directed substitution mutation by quick-change method on linear dsDNA? or it has to be cloned in some vector? If yes, should it be treated with the Dpn1 enzyme...

03 March 2021 401 4 View

How to repeat an operation on an atom selection for multiple times in PyMol?

Hi, I am trying to construct a multi-layer fibril structure from a single layer in PyMol by translating the layer along the fibril axis. For now, I am able to use the Translate command in PyMol...

02 March 2021 4,569 4 View

Sebastian Lungu-Mitea

Hey Hafiz,

if I understand your scenario correctly, you should have no issues with using your vector in transient transfection.

Best

Hafiz Muhammad Rizwan

1- Use the same vector for Transient expression: the ready construct by instant injection method?

2- Can you please share the protocol for the Transient expression from the construct to the end?

3- As I am working on wax-related genes so will use Tobacco for transient expression so which one should use a) Nicotiana tabacum, b) Nicotiana benthamiana?

Thank you very much