Can anyone help me how to get the similar bands in Actin?

I run western blot on HCT-116 cell lines, I got actin band like in the attached picture. The band size is not same. Can anyone help me explain this situation and how to overcome? Thank you your...

22 February 2021 6,937 3 View

Is there any solar electric power plant having the concentrated photovoltaic modules?

The solar photovoltaic (PV) power plant uses commercial (non-concentrated) PV modules which are quite simple in design and reliable. They can work on fixed orientation and don't need the moving...

16 February 2021 3,796 9 View

Control in microstructure with growth inhibitor?

Dear researchers, I wish to understand the role of grain growth inhibitor in controlling the microstructure of the ceramic pellet. How it controls the growth? Also, I wish to know the grain...

15 January 2021 3,859 3 View

Does behavior (shy vs bold; rare vs abundant) and flock size (small vs large) of bird species play role in niche partitioning among sympatric species?

Sympatric birds may avoid competition via multiple strategies - by different activity period, different diet, different microhabitat etc. Has any one looked into behavior of sympatric birds as...

11 January 2021 9,600 1 View

How big the Balb/c mice spleen after immunization?

I am working with Balb/c mice, and in my experiment, I have to inject mice with antigens, then get their spleen and collect the splenocytes for fusion. Recently, I get into trouble with the mouse...

04 January 2021 3,591 3 View

Buckling of Smart composite plates using FEM ( MATLAB code)?

Can anyone help me with the FEM coding for Buckling of composite plates using the FSDT or HSDT - Source or the helping material (textbook, research paper etc) - Geometric stiffness matrix...

03 January 2021 3,059 3 View

Capture of oleophilic solid polymers present in water solution ?

I am looking for articles, coferences, publications or thesis concerning the capture of solid oleophilic polymers in solution in water. Thanks Thierry Le Blan

01 January 2021 5,798 3 View

Optimization technique in ball mill?

Hi all, I wish to know about a common problem faced by most of the researchers who are dealing with ceramic materials that my ceramic powder is sticking with the balls after the operation. can...

02 December 2020 8,232 3 View

Hybridoma stops producing antibodies after thawing from liquid nitrogen?

Dear scholars, Our research is currently involved with hybridoma technology. We have isolated some original clones after fusion and we are preparing the subclone step to find some true positive...

01 December 2020 1,178 3 View

Smear in PCR product after purification, how to get rid of it?

I've done a PCR using primers Forward: CGCCATCAAGGTACCAGTTGA and Reverse: CAGGCTCAGGTACAGCTGGTGG AGTCTGG saw a band at around 400bp and purified my PCR product using QIAquick PCR Purification...

28 November 2020 1,701 7 View

error in running a model in Abaqus

Excessive rotation of nodes in node set ErrNodeExcessRotation-Step1

17 August 2021 0 0 View

error in modelling model in Abaqus

Excessive rotation of nodes in node set ErrNodeExcessRotation-Step1

17 August 2021 0 0 View

MGL tools

20 June 2021 0 0 View

How climate change will influences human and animal behavioral change?

The role of climate change influencing the human behavior as well as economics interest

01 June 2021 0 0 View

flexibility of polymers chain

effect of double bond on the flexibility of polymers

07 April 2021 0 0 View

i have some problem with chtMultiRegionSimpleFoam

--> FOAM FATAL ERROR: Maximum number of iterations exceeded From function Foam::scalar Foam::species::thermo::T(Foam::scalar, Foam::scalar, Foam::scalar, Foam::scalar (Foam::species::thermo::*)(Foam::scalar, Foam::scalar) const, Foam::scalar (Foam::species::thermo::*)(Foam::scalar, Foam::scalar) const, Foam::scalar (Foam::species::thermo::*)(Foam::scalar) const) const [with Thermo = Foam::hConstThermo >; Type = Foam::sensibleEnthalpy; Foam::scalar = double; Foam::species::thermo = Foam::species::thermo >, Foam::sensibleEnthalpy>] in file /home/ubuntu/OpenFOAM/OpenFOAM-4.1/src/thermophysicalModels/specie/lnInclude/thermoI.H at line 66. FOAM aborting #0 Foam::error::printStack(Foam::Ostream&) at ??:? #1 Foam::error::abort() at ??:? #2 Foam::heRhoThermo >, Foam::sensibleEnthalpy> > > >::calculate() at ??:? #3 Foam::heRhoThermo >, Foam::sensibleEnthalpy> > > >::correct() at ??:? #4 ? at ??:? #5 __libc_start_main in "/lib/x86_64-linux-gnu/libc.so.6" #6 ? at ??:?

24 March 2021 0 0 View

Formulation of polymer color flakes

I am writing to request some information for making polymer color flakes. I would appreciate the help.

17 March 2021 0 0 View

What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10?

What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10? Since, the growth curve from day 2 to 10 won't be like the "Logistic curve" it might not follow logistic...

03 March 2021 1,401 3 View

What is the production process of CaFe ferroalloys?

I looking for ferro calcium production process

03 March 2021 1,755 4 View

Resistor definition in Piezoelectric bimorph with ANSYS workbench

Hello, good day! I am trying to simulate similar bimorph piezoelectric harvester with below commands. However, the output power doesn't change with resistor value. Please help to find the reason. ET,10,CIRCU94,0 !SET UP RESISTOR R,1,100000 !RESISTANCE VALUE TYPE,10 !SET ELEMENT TYPE E,1,2 !CREATE RESISTOR BETWEEN NODES 1 AND 2 Thanks in advance Regards,

02 March 2021 0 0 View