We are using a Sanger sequencing like method (includes a PCR clean up step, sequencing reaction and finally clean seq removal kit) to sequence PCR products. However someone said that you can sequence vectors without prior PCR amplification and then skipping the PCR purification step?
Yes you can, vectors can be sequenced with nice results. You can even use proven sequencing primers, such as -21M13 (just check your vector type for present primer sites).
Yes you can, vectors can be sequenced with nice results. You can even use proven sequencing primers, such as -21M13 (just check your vector type for present primer sites).
I concur with Tomas; have personally sequenced the subcloned ORFs by submitting purified bacterial plasmids. This was of course done after colony PCR / cultures ensuring that I sequence insert(+) clones. You can use the general priming sites available in each vector, respectively.
The pGEM-T-easy vector includes T7 and SP6 promoters. There are standard oligonucleotides for these promoters. This way, you can directly sequence both ends of your insert.
I agree with the previous answers: why amplify by PCR when bacterias can do it for you? With much less errors than Taq polymerase! Just do a mini-prep of your plasmids and as suggested above use the T7 and/or SP6 oligos to sequence, pretty simple!
T7: TAATACGACTCACTATAGGG
SP6: CATACGATTTAGGTGACACTATAG
Good luck!
In addition to the T7 and SP6 primers, you may also sequence inserts in the pGEM backbone using M13 Forward and M13 Reverse. The use of such universal primers to sequence inserts cloned into standard vectors was the basis of many genome sequencing projects in the past. As others have pointed out, there's no need to amplify your insert by PCR for sequencing - that just introduces error and wastes time/reagents.
Good luck.
- Badges
- Science method