Hi Atoshi,

The IRES will alter the secondary structure of your LncRNA. Plus it will change its localization and force it to bind to ribosomes for the translation of your reporter gene (it's sill a unique RNA). You should use something different, perhaps self-cleaving tRNAs preceeding the IRES to make a policystronic mRNA.

I would anyway rather use a second promoter to drive the reporter gene expression if it still fits within the 8Kb backbone of the Lentivirus.

Also, usually lentivirus do not fit PolyA sequences as that would undermine their production and packaging. In absence of a PolyA, I suspect you LncRNA will always carry the 3' sequence of the lentivirus until the 3'LTR.

Maybe using Adenovirus, Baculovirus or other delivery systems which do not rely on RNA viruses will help.

You can also overexpress your LncRNA with CRISPRa technology. You could fit everything into a lentivirus in that case, and let the inactive Cas9 fused to a transcriptional activator take care of upregulating the endogenous LncRNA promoter through a panel of promoter specific sgRNAs.

Hope it helps

Francesco

you can try with Y1H

Couple of good points by Francesco. I would not tag your lncRNA with GFP since 1- GFP needs to be cytosolic to be made and your lncRNA may have nuclear functions and may localize to the nucleus and 2- as mentionned above the GFP tag is rather large for a (I assume) relatively small (< 1 Kb) lncRNA. However given the difficulty in introducing genes in neural cells, I would stick to lentivirus delivery and a dual expression cassette system (should easily fit the lentivirus limit packaging size). Other option is to label your RNA with other RNA specific tags (e.g.M2), although they are rather large and may affect function/localization as well.

Good luck!

Thanks All

I will try to clone GFP under a second promoter and see if it works.

Hi Francesco Aulicino

Can you suggest from which plasmid i can get the self cleaving tRNA sequence, i tried searching but they all are used for CRIPSR gRNA scaffold and are bit confusing to me.

Thanks '

Atoshi

Hi Atoshi,

Self-splicing tRNA sequences have only been used for gRNA scaffold that I know of. It should work also in your case however. As others, we also have used this for gRNA expression in this paper Article (Po)STAC (Polycistronic SunTAg modified CRISPR) enables live...

The sequence of the hGly-tRNA is as follows:

(AACAAAGCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCCACGCGGGAGGCCCGGGTTCGATTCCCGGCCAATGCA)

Below, embedded in a bicistronic gRNA cassette from the paper:

https://doi.org/10.1093/nar/gkx1271

>hU6 Promoter_Human tRNAGly_sgRNA MUC1-E1(F+E)_ Human tRNAGly_sgRNA MUC4-E3(F+E)_Terminator:

TTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACG(AACAAAGCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCCACGCGGGAGGCCCGGGTTCGATTCCCGGCCAATGCA)GCTCCACCGCCCCCCCAGCCCAGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC(AACAAAGCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCCACGCGGGAGGCCCGGGTTCGATTCCCGGCCAATGCA)GTGGCGTGACCTGTGGATGCTGGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTGTTT

I cannot assure you that will work in your case, but I guess it's worth trying.

All the best

Francesco

Thanks @ Francesco Aulicino

I am trying to clone the PTG sequence in between 2 RNA species and hope it works. Will it also work in mouse cell line or I need to make mouse tRNA for that.

Atoshi

Yes we've used it in mouse and human cells, there's no difference in their ability to process polycistronic gRNA in these species. The tRNAs are identical.

Hope it works, good luck

Francesco