Hi, guys.
I am doing PCR on tdtomato. I can't get a clear product band. The unspecific bands are always stronger than the band I need. I think it may be explained by the fact that tdtomato consists of two copies of tandem domain. But both primers are out of the tandem sequence. I cut the band of the right size and use it as a template for a bridging PCR to creat IRES-tdtomato. I still can't get what I want as well. Do you know how to solve this problem?
It seems that you have two problems, which can be connected. First, what is the size of your PCR products, expected and unexpected? Best regards,
I believe you might have single stranded PCR product . Probably one of your primers is binding more efficiently. Give it longer extensions / final extension or use MungBean nuclease at the end of the PCR. my2c
Hi,
I designed my own primers on tdTom recently. Be careful, there are different variants of tdTom, so be sure that you have the right sequence. Our transgenic mice have this variant of tdTom - http://www.ncbi.nlm.nih.gov/nuccore/AY678269.1. Primer sequence is fw - ACATCCCCGATTACAAGAAGC, rv - TTGTAGATCAGCGTGCCGTC. Product size 130bp, E=0,976, single product on gel.
Good luck;)
Hi， Guys，
Thank you.
I have made it. I did some change to my protocol. I use Kapa Hifi. Reduce template to 1ng/50ul system. I used to use 10ng-30ng. I use nesting PCR. The outer primers to amplify the IRES and tdtomato separately, and using 0.5ng IRES, 0.5ng tdtomato as template, using inner primers to do the second round PCR. I still got two bands but one is right and strong enough. I purify it on gel. I increase annealing temperature from 60 to 65. Extension temperature from 68 to 72. I did some controls and I can tell that lower the template concerntration and two sets of primers are the two most important factors for the improvement.
i am facing problem in td. tomato qPCR. can any body give me his/her primer sets sequence to test?. i have designed many but not working. help me
- Badges
- Science method