We used the following method in our experiments to detect TNFα: in mouse primary astrocyte cultures. Hope it helps.

RNAs from wild type and conditional p38 knockout astrocytes were extracted using Trizol LS Reagent according to manufacturer׳s instruction. Quantitative real-time PCR was performed using SYBR Green PCR Master Mix (Promega) and 7300 real-time PCR system from Applied Biosystems. Two-step real-time PCR protocol was used (95 °C for 15 s, 60 °C for 60 s extension and detection, 40 cycles). Sequences of primers for real-time PCR are listed as following:

TNFα:

Forward 5׳GCCTCTTCTCATTCCTGCTTGT 3׳

Reverse 5׳ CAGGCTTGTCACTCGAATTTTG 3׳

if you want you can stimulate astrocytes with LPS to induceTNFα  production and then try use the sample for RT PCR.

All the best.

Thanks Gaurav,

i do have primers designed at hand. Teh problem is , the assay is not working and i want to figure out whether the issue is with the reaction set up, primer concentration, or the primers and probes themselves. I want to check the expression of TNF alpha in response to our treatment. I presume there is a basal level of TNF alpha expression in astrocytes (cultures from P0 wistar rats), and though a low expression, is detectable. Could the problem be with the assumption itself?

Thank you.

Its better you try Hold 95 c- 10 min, Cycle 95 c - 15 sec, 60 c - 30s, 72 c - 30s. I also faced the same problem but this protocol gives solution. You can try.

Hi,

I found this article  (attached) where it was mentioned that "Rat astrocytes do not constitutively produce TNF-alpha and need stimulation" may be that is the reason in your experiment you do not detect basal TNFα. 

You can try stimulating them to see fold change in expression. that way you can make sure that your set up for PCR  is working .

Good luck

Article Tumor necrosis factor-α production by astrocytes. Induction ...

do the optimization on the sample that does express tnf-a. On basal levels there is no much tnf-a, so whatever you can detect is not really specific.

Thanks all,

Gaurav: Another study done later in 1996 has shown that it is constiutively expressed in glia, albeit expression is less.

(Reference: L. C. Gahring, N. G. Carlson, R. A. Kulmar, and S. W. Rogers, “Neuronal expression of tumor necrosis factor alpha in the murine brain,” Neuroimmunomodulation, vol. 3, no. 5, pp. 289–303, 1996.)

Positive control seems to be a good idea. i will acquire one shortly and run the reaction.

Thanks for the suggessions again! Much appreciated.

In this case your assay mix may have some problem. Reporters are often photo degraded with improper storage and not giving polymerization at all...Check with maximum cDNA concentration with standard house keeping genes & if still no results then definitely primer-probe mixture have a serious issue to deal with..

Did you use random primer for cDNA synthesis, as you mentioned that 18S duplex worked? If so, try not to use this type of cDNA as template. Instead, use oligodT or mixture of oligodT with hexamer (for the latter, it is better to use commercial kits like that of BioRad that was available before, not sure if it is still available). Thermal cycle conditions you should follow others have advised, but consider 95C for 5 min or so for initial denaturing, cycles with annealing/extension temp of 55C or so (because your Tm is quite low) for 30 sec or so (no need to do 60sec unless you are amplifying really long product, which would not be good for real-time PCR anyway. Good luck.

Thank you Senjie!

My amplicon is just 109 bp. I think reducing the time and temperature should be a better idea.