Hi all! I'm planning a Real Time PCR (SYBR Green) to to determine the amount of expression of Human Catalase (CAT) in human cardiomyocyte. I compared some primers found in the literature but none of these it seemed valid to me. Anyone has used a valid CAT primers?
Thank you in advance!
How does it seem valid? Did you cross-check using blast?
You can simply design your own primer in the NCBI Primer blast.
If specificity is the issue I would recommend selecting primers based on exon junction, to avoid false positives by DNA contamination.
Yes, I cross-checked using Blast. I know that I can design my own primer, but I'm not skilled yet and I need to order it as soon as possible.
I'd rather recommend that you use this one primer pair:
CAT Forward: ACATGGTCTGGGACTTCTGG
CAT Reverse: TTTGCAATAAACTGCCTCCC
Obtained from Amos DL, Robinson T, Massie MB, et al. Catalase overexpression modulates metabolic parameters in a new 'stress-less' leptin-deficient mouse model. Biochim Biophys Acta Mol Basis Dis. 2017;1863(9):2293-2306. doi:10.1016/j.bbadis.2017.06.016
Mariangela Mazzone Dear Mariangela,
This is the human primer pair. The murine pair is also cited in the same paper, but right next to the first primer pair potentially causing confusion.
These are once again the primers for H. sapiens -> Forward: ACATGGTCTGGGACTTCTGG Reverse: TTTGCAATAAACTGCCTCCC
You can check the exact genomic location of the primer sites using the "in silico PCR" tool in the UCSC database.
- Badges
- Science method