I am having trouble finding a suitable primer for human PDGFR-B. Has anyone successfully used a primer and if so what was the annealing temp?
Using http://primerdepot.nci.nih.gov/ I got the following output
Primer Information
Gene Name: PDGFRB RefSeq ID: NM_002609 Chromosome: chr5 Strand: -
Transcription: 149515503-149473595 Number of introns: 22
Right primer sequence: CAGGAGAGACAGCAACAGCA Position: 220 Length: 20 GC%: 55 Tm: 60.333
Left primer sequence: AACTGTGCCCACACCAGAAG Position: 115 Length: 20 GC%: 55 Tm: 61.163
cDNA amplicon size:106 Estimated genomic amplicon size:18449 in silico PCR
Right primer sequence: CAGGAGAGACAGCAACAGCA Position: 220 Length: 20 GC%: 55 Tm: 60.333
Left primer sequence: TGTCCAGAGCCTGGAACTGT Position: 101 Length: 20 GC%: 55 Tm: 60.861
cDNA amplicon size:120 Estimated genomic amplicon size:18463 in silico PCR
Right primer sequence: GCCCTGAGAGATCTGTGGTT Position: 250 Length: 20 GC%: 55 Tm: 59.258
Left primer sequence: TGTCCAGAGCCTGGAACTGT Position: 101 Length: 20 GC%: 55 Tm: 60.861
cDNA amplicon size:150 Estimated genomic amplicon size:18493 in silico PCR
We have used that website a number of times to find primers for qPCR with good results. However, it is important to understand that these primers are computationally identified and not experimentally validated--you must do this yourself. Also, while the program tries to identify three primer pairs, primers are often identical in several of the sets (as in this case--there are only 2 unique forward and 2 unique reverse primers). We usually order multiple primers and first test combinations that yield a unique product of the correct size. Then we measure the efficiency of the 'good' primer combinations. Finally, this algorithm is designed to identify primer pairs for SYBR (or other intercalating dyes) so the amplicons are short--you should set up your PCR reactions for zero extension time (directly from annealing to denaturation) as the polymerase will be able to make the full-length amplicon in the time it takes to ramp up to the denaturation temperature. This reduces the likelihood of longer amplicons being generated and speeds up your qPCR reaction.
- Badges
- Science method