How to implement monte carlo method to compute state value in matlab ?

assume there are 80 states each with a possibility of 2 actions. we have a predefined reward function. The problem is about research allocation.

30 October 2020 9,930 3 View

I am trying to use Modified cam clay as soil model in the simulation of an excavation problem in FLAC. I am getting an error. Can someone help?

The error says "Current value of tangent bulk modulus is larger than maximum input value". Input parameters were taken from a journal. When I try changing the bulk modulus, the error message is...

08 October 2019 5,267 3 View

What is the different between model, architecture, framework, and protocol in computer science?

I know this question is clear but I want to know the difference between these facts especially in computer science?

31 May 2019 5,710 2 View

Why the crack propagate in that direction (to the left hole)?

Left side of the specimen is applied with fixed support and load is applied downward on the right hole. I need an explanation why the crack propagate to left hole. What i have in mind is since...

18 February 2019 2,159 1 View

Why so called dark matter is outside the galaxy?

The so called dark matter is pictured out side the galaxy. What is the reason? why cant it be a part of the galaxy itself ?

03 September 2018 155 4 View

Can non-motile bacteria perform chemotaxis?

Most model for chemotaxis are flagellated bacteria. Im just wondering how this non-motile organisms adapt to starvation or repellent. If you can provide me some journal article that would be...

02 March 2018 9,880 3 View

Why high ROS signal in flowcytometry and fluorescence microscope?

Hello I want to investigate the effect of high temperature on ROS production in yeast. I have yeast cells which grow at 30 degree as a control and experiment cells grown at high temperature.I used...

21 April 2016 8,392 5 View

If two proteins run in sds page with different molecular weights, if both show bands with same intensity, does it mean they have same concentration?

If two proteins run in sds page with different molecular weights(having difference of 60 KDa),if both shows bands with same intensity,does it mean they have same concentration?

03 November 2015 9,304 3 View

Serum starvation in cell line treatment?

How long after seeding of cell line, should I do serum starvation or serum 4%? 24 h or less? How long should it last (before treatment) or serum 4%? 24 h or less? i i want to do serum starvation...

05 December 2014 8,834 3 View

In SDS PAGE, actin crosslinking doesn't show any significant increase in mass comparing actin bindings - any thoughts?

Can anyone help me to explain while running my protein samples in SDS PAGE, Actin crosslinking doesn't make any significant increase in molecular mass comparing actin binding protein samples.

29 August 2014 9,634 3 View

Ester cleavage conditions?

Hi all, I need to cleave the ester in Ethyl 2-amino-1H-imidazole-5-carboxylate to make the carboxylic acid and retrieve the product from solution to use in downstream applications of linking to...

01 March 2021 8,766 3 View

How to prepare a thin polymer film by post-polymerization/crosslinking?

24 February 2021 2,362 5 View

Can anyone help me how to get the similar bands in Actin?

I run western blot on HCT-116 cell lines, I got actin band like in the attached picture. The band size is not same. Can anyone help me explain this situation and how to overcome? Thank you your...

22 February 2021 6,937 3 View

Hi, can anybody help me with the suggestions how can I amplify a stress induced gene of 1107 bp?

I am trying to amplify the TGA1 (Transcription factor 1 ) of Arabidopsis ,which is 1107 bp. I have treated the plants with Salycylic solution over night and extracted the RNA and make cDNA. I...

17 February 2021 7,802 2 View

How do you prepare a porous crosslinked Polyvinyl alcohol and Glutaraldehyde membrane or film?

I am trying to prepare a Polyvinyl alcohol membrane for carbondioxide adsorption

08 February 2021 7,493 3 View

Why are my western blot bands so distorted?

Hi guys I'm out of ideas here please help! I've never had consistent problem like this doing westerns before and I can't figure it out. The condition used: - First 4 lanes have 50ug protein in...

04 February 2021 2,297 3 View

How can I set up UV irradiation for crosslinking lab?

Hi, I am using a mix of 2 polymers and want to try and crosslink them. I have a UVA lamp of 365nm and have tried the lab previously at 30cm above. How would you recommend I approach the lab and...

31 January 2021 8,711 3 View

After G actin polymerization and labelling I didn't got filaments. Why?

Purified G actin and got 42kda band and an additional band just below it. While performing G actin polymerization and labeling with rhodamine-phalloidin I didn't observe filaments under the...

20 January 2021 3,751 2 View

Why am I seeing multiple bands for beta-actin PCR?

I performed a PCR run on human DNA with the beta-actin primer (F: GCCATCCTGCGTCTGGACCTGGCT; R: GTGATGACCTGGCCGTCAGGCAGC). PCR setting: 98degree 30sec, 30cycle of (98degreeC 10sec, 64degree 30s,...

14 January 2021 6,544 2 View

What is the reason for observing two bands of beta-actin after lipofectamine transfection of keratinocytes cells?

25 December 2020 8,668 3 View