hi,

you can get auround this problem by increasing the size of your primers. How many nucleotides use. How many nucleotides make up ?

Moreover, it's possible than your gene exist in several copies in your genome. Have you check this ?

Dear Yoann Perrin,

My previous primers are 22bp and 23bp. I design a new pair, whose length are 28bp and 30bp separately. 

I think the gene only locates at chromosome 6. But I'm curious, for other genes, if I want to check, how can I do?

Thanks! 

Dear Shuai Chen,

Our names look so alike in English! Haha.

I use NCBI primer tool to design primers. I think it uses the same program as primer 3. Am I right?

I only checked the forward primer. After I found it can bind to other site, I just regard it's not proper. 

Actually, in NCBI primer tool, if not misunderstand, there is an option to check Primer Pair Specificity. I assume after this, the primers I get can not be bound to other location. I'm not sure about this because if I use the primers for blast, it can still show me other binding sites. So how you check primer specificity? Use primer 3 to design and use NCBI blast to check?

Thanks!

On NCBI you can check amplified sequence with both primers .

In your request : [sequence primer 1]nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn[ sequence primer2]

do you see what i mean? If your primers are specific, you will have only 1 hit.

You can check the number of copies in your genome if you "blast" your gene

 of interest : 1 hit = 1 copy, X hits = X copies 

Dear Yoann Perrin,

I guess I understand what you mean. Do you mean to type "[Forward primer]my aimed sequence[Reverse primer]" in a certain input box? If so, I didn't fine that box. Could you please give a link and tell me which tag to select? Because there are several choices on NCBI blast. 

Thank you so much!

Thank you Shuai Chen!

I think I need ask the same question as I asked Yoann Perrin since I didn't find the input box.

For example, I want check this primers :

forward : ATATATATATATATATATAT

reverse : GCGCGCGCGCGCGCGCGC

So, I enter this in query sequence :

ATATATATATATATATATATnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnGCGCGCGCGCGCGCGCGC

(no modify n !!)

I choose my target organism (as accurately as possible)

In program selection, Optimize for Somewhat similar sequences (blastn).

you get sequences that can be amplified by your primers.

There are two useful tools in the UCSC genome browser. BLAT is like a quick BLAST but gives you a visual result of exactly where your fragment(s) will bind. The In Silico PCR tool allows you to input your primers and again it will map which, if any fragment will be amplified. Don't dismiss your primers if one is binding to more than the desired site- if the other primer binds only to the desired site you should still get amplification of your product. 

Dear Shuaichen Liu,

Do you know Primer BLAST (please forgive me if it has been mentioned before, I haven't read the thread carefully ;) )? Link: http://www.ncbi.nlm.nih.gov/tools/primer-blast/

Now to use it:

1) In the primer parameters fields enter sequences of your primers, specify minimal and maximal product size. If you want to verify if your primers can give unspecific targets of similar size to your product then make sure right PCR size is selected. Very important, make sure that max size is some bp longer than your expected PCR product, otherwise program might say your primers don't amplify selected region!

2) I ignore next field - Exon/intron selection since I work in intronless organisms ;) If you want to amplify genomic sequence and don't care about intron-exon junction, then ignore it as well.

3) Primer specificity Checking - important field, choose database (Genome (reference assembly from selected organisms) would be good for start here), Choose organism (by default in my browser it is homo sapiens), and to simply find binding sites and products I only specify max target size.

4) Tick box "show results in a new window" :)

5) press get primers.

This is what I suggest to my students who want to analyze binding sites for primer pairs or to find an expected product length, or unspecific products.

Hope it helps.

Best,

Pawel

Dear Pawel,

I did as you said, put my forward and reverse primers in and set the parameters you mentioned. Luckily my primer pair is unique to indentify the aimed sequence.

But another question confused me. My aimed PCR product is ~7.7kb and I want to amplify it from genomic DNA.

My forward primer is GCATTTGGTTGTCTTGGTTTGGTATGTC and

my reverse primer is GTTGGGTGTGAGACATAGAGAATAAAAGGG.

If I use another blast tool http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome. Put forward primer sequence in Query Sequence and then choose Human genomic transcript (Human G+T). Then blast. In this way, I can see my forward primer can bind to several places. Is this blast method right? If it is right, is it contradict to your method?

I tried this pair of primers to PCR the ~7.7kb fragment form placenta DNA,using Roche Expend Long Template PCR System, but didn't get product. I just wonder whether something is wrong with my primers.

Thanks for your answer!

Dear Collette K Hand,

I tried the website you mentioned. It's much faster than NCBI blast! But I don't know how to interpret the result. For BLAT, I attach the screen print. For the In Silico PCR, the results are:

>chr6_GL000254v2_alt:820643-828390 7748bp GCATTTGGTTGTCTTGGTTTGGTATGTC GTTGGGTGTGAGACATAGAGAATAAAAGGG

>chr6_GL000250v2_alt:820934-828682 7749bp GCATTTGGTTGTCTTGGTTTGGTATGTC GTTGGGTGTGAGACATAGAGAATAAAAGGG

>chr6_GL000253v2_alt:820398-828146 7749bp GCATTTGGTTGTCTTGGTTTGGTATGTC GTTGGGTGTGAGACATAGAGAATAAAAGGG

>chr6_GL000252v2_alt:820782-828529 7748bp GCATTTGGTTGTCTTGGTTTGGTATGTC GTTGGGTGTGAGACATAGAGAATAAAAGGG

>chr6_GL000255v2_alt:820738-828486 7749bp GCATTTGGTTGTCTTGGTTTGGTATGTC GTTGGGTGTGAGACATAGAGAATAAAAGGG

>chr6_GL000251v2_alt:1041720-1049467 7748bp GCATTTGGTTGTCTTGGTTTGGTATGTC GTTGGGTGTGAGACATAGAGAATAAAAGGG

>chr6:29555239-29562986 7748bp GCATTTGGTTGTCTTGGTTTGGTATGTC GTTGGGTGTGAGACATAGAGAATAAAAGGG

Do these mean my primers can actually amplify 7 fragments? I see they are all in chromosome 6 and the length is quite alike. Does this mean my gene has 7 copies in chromosome 6?

Thanks for your reply!

Hi Shuaichen

Yes, those are the results you get using in silico PCR tool. 

They all map to the UBD/ GABBR1 gene region on chr6. 

I'm not sure what is meant by chr6_GL000xxxx - they look like alternate assemblies of small portions of that region. I don't think you would actually get all 7 products by PCR. Using genomic DNA I expect you would amplify the last hit-  chr6:29555239-29562986 , giving a 7748bp product. 

If you use the in silico PCR tool and then BLAT all of the results, select one of the hits that maps to chr6 and you see that all of the PCR products align on the same region of human Chr 6- figure attached. So I do believe that you would just get the one product

I hope this helps

Collette 

Dear Collette,

Thank you so much for your reply!

I see what you mean. I want to get the same figure as you attached but didn't success. Do you mean in the same way, do in silico PCR first. And then copy the results and paste them into BLAT? Appreciate if you can tell me more detail. Thanks again!

Hi Shuaichen

Yes- do in silico PCR using your primers. Then copy the results (all 7 hits) and paste into BLAT. You will need to modify the text slightly:  Multiple sequences may be searched if separated by lines starting with '>' followed by the sequence name. So separate out the 7 hits in this way - then you should get the same results I did. 

>chr6_GL000254v2_alt:

SEQUENCE

>chr6_GL000250v2_alt

SEQUENCE

etc