Hi Everyone, i have a Sequence of 16s rRNA, when i tried to generate CAP- Contig using BioEdit, am getting Multiple Contigs for a particular strain, but when i tried with some other strain am getting single contig.
1.Can it be the problem with sequence i had recieved ?. OR
2.I had used 16s rRNA Universal primer- fD1 (5’AGAGTTTGATCCTGGCTCAG 3’) and
rP2 (5’ ACGGCTACCTTGTTACGACTT 3’)
I prefer DNA Baser over bioedit in generating contig. You just have to import the sequencing file(raw file is better than fasta as it can compare the chromatogram from forward and reverse sequence) and it will automatically do the needful action.
Good luck...
http://www.dnabaser.com/
Chongtham Rajiv I dont think dnabaser is a freeware, let me try it once. i have downloaded Staden Package as Artur Burzynski said,
Thanks for the reply ! :-)
- Badges
- Science method
- Similar topics
- Biological Science
- Genetics
- Genetic Analysis
- genetic techniques
- Sequencing