Why does a Nested PCR protocol amplify samples and not amplify positive control?

I have this problem. Today I used a new positive control of an isolated NC-1 strain in cell culture and the problem persists. I performed a serial dilution test to test the sensitivity of the...

08 December 2020 6,252 2 View

How to avoid the formation of traces and dimers in DNA gel electrophoresis?

07 December 2020 3,052 3 View

Is the pipetting order of the positive and negative controls in the PCR important to avoid in a possible contamination?

I have been watching bands form on my negative controls. I have already changed all reagents, optimized the hygiene of materials and the environment and increased care in pipetting.

07 December 2020 9,090 3 View

How to standardize and obtain a good PCR reaction with samples with a low and variable amount of DNA?

I work with the detection of N. caninum DNA in milk samples in milk samples. The DNA concentrations in my samples range between 2-90 ng / ul. I would like to establish and standardize a final...

01 December 2020 8,792 3 View

Measure of intracellular lactate?

Hi! I will try to measure intracellular lactate through lysing the cells in 20 mM Tris-HCl, 150 mM NaCl and 1% NP40. I'm going to use a clinical kit, which is constituted of Pipes buffer, pH 6.8....

30 January 2020 5,211 2 View

Dissolved oxygena DYE for cell culture?

Hi, I am looking for a dye to monitor O2 changes in cell culture media. I would like to have it colorimetric and not fluorescent but since I am not finding anything I could to fluorescent too! I...

23 October 2018 5,895 2 View

How do I determine the sample size to evaluate the performance of an image segmentation algorithm?

I have three image segmentation techniques that I have developed. I wish to compare the performance of the segmentation techniques using measures such as BDE(boundary displacement error),...

11 October 2018 2,021 5 View

Most appropriate Feature Selection to find indicators that are most correlated to the number of one event?

I have two databases. One of them contains the number of this event per year. The other one contains a lot of indicators and its values per year. I want to find those indicators that are most...

20 March 2018 3,610 4 View

Which is the best way to treat ticks and fleas for morphological identification before performing molecular investigations?

Hello all, I am trying to attempt morphological identification of ticks and fleas collected in Wales on wild small rodents. My samples have been frozen and after the morphological identification I...

10 October 2017 7,374 4 View

Is it a problem to have a positive dG in primer self dimer?

5' GGCATGTAACGAATTTCTTC 3' +++ ||| 3' CTTCTTTAAGCAATGTACGG 5'dG: 1.5 Data from Gene Runner

24 May 2015 4,243 6 View

Why might my GFP tag be dissociating from my plasmid after transfection?

I have a set of stably transfected cell lines all transfected with plasmids containing GFP tags on the C terminus. During a western blot using anti-GFP antibody, one of my plasmids has dissociated...

01 March 2021 9,310 4 View

Do you need the CMV enhancer before the CMV promotor for a proper function of CMV on the gene that follows?

I'm a student and I have to produce a cell line with a knockin for the NRF2 gene with GFP. I have to put a promotor in front of the GFP because the gene will be too far away from the promotor of...

28 February 2021 7,127 2 View

The reason that the culture of white fungi Contamination with green mold(Trichoderma), the culture autoclave at121 for 15 min. What is it?

Is the period to autoclave not enough? The inoculation in a hood and flame and UV and alcohol.

27 February 2021 9,356 3 View

No amplification data for qPCR on MxPro?

I have set up a qPCR run on MxPro with SYBR green and ROX as a reference, however, when I go to the analysis section the program seems to only collect data for the dissociation curves and not the...

25 February 2021 8,039 1 View

Problem with ligating 2.8 kb insert into 8.5 kb plasmid?

I am trying to clone 2 copies of the same mammalian gene into the pSF-CMV-Ub-Puro Ascl (contains HindIII, KpnI and NheI cut sites) plasmid. This is what the final product is supposed to look like...

24 February 2021 6,310 3 View

Color of spiro-ometad film?

What does the color of a spiro-ometad film indicate? I got purple, green, red, even black color of the spiro film. Is there anything we can get from the preliminary color analysis(e.g. oxidation...

21 February 2021 1,831 4 View

Has anyone encountered any problems with abm good microRNA primers for quantification of mature miRNAs?

I've been trying to quantitate mature microRNAs in 293T cells with and without 'X'. 2ug of total RNA (isolated by Trizol method) is converted to cDNA using All-in one microRNA cDNA synthesis kit...

17 February 2021 8,986 2 View

Does the property of GFP affect a fusion protein's localization?

Hello, I am planning to insert GOI between CaMV 35 promoter and mGFP in pCambia1302 to produce a fusion protein and see subcellular localization of the protein. But the vector says it's membrane...

15 February 2021 4,353 3 View

How do you prepare a standard dilution for qPCR?

I am very new to quantitative PCR and need some help for this technique. For my experiment, I need to perform a quantitative reverse transcription PCR. I extract the RNA from my pellet and...

05 February 2021 9,834 4 View

P53 detection in methylated and non methylated samples?

Hello everyone. I am about to search for the expression of genes including p53 in methylated and non methylated HPV samples. Should I extract DNA from the methylated samples and use SYBR green...

04 February 2021 2,749 3 View