Dear ResearchGate community, I would like to be certain that I am using the 'gold standard' primers to perform DNA-barcoding of unknown Trichogramma spp. samples. I am planning to use the primers published in Silva, I.M., Honda, J., van Kan, F., Hu, J., Neto, L., Pintureau, B., Stouthamer, R., 1999. Molecular differentiation of five Trichogramma species occurring in Portugal. Biol. Control 16, 177–184 :
5' > TGTGAACTGCAGGACACATG < 3' (forward) and
5' > GTCTTGCCTGCTCTGAG < 3' (reverse).
Would this pair of primers be the optimal choice for Trichogramma spp.?
And, a more general question: Is there a list of the best (or, most used) primers applicable for the DNA-barcoding of specific insect groups (e.g. Lepidoptera, Coleoptera, Aphids...)?
Thanks!
You can use databases such as boldsystems:
http://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxon=trichogramma&searchMenu=taxonomy&query=trichogramma
There you can find more information on this and also primers and lots of other help. For Trichgramma next to the usal COI primers ITS-2 sequences were used, not sure if this is still true.
Hello Jaka
In Trichogramma the most commonly used primer will be LepF1/ LepR1 I guess
But really best to check in BOLD as Peter suggested above
I know of no General list of best primers but in most of the Groups you asked LepF1/ LepR1 and LCO/ HCO will be the most widely used.
- Badges
- Science method