I had 9 pairs of primers added with 4 different M13 tails, two of the 9 pairs primers can not amplify any thing after adding the M13 tails, other 7 pairs worked well. I did not see any small bands on gel, I guess it was not because of primer dimer. Has anyone had this situation before? What might be the problem? Thanks!
I assume that you have not changed the annealing temperature....you cannot use the entire sequence of the primer to calculate annealing temperature in the early cycles of pcr as only the specific 3@ end of the primer has a complementary sequence. Otherwise it may be possible that the reverse primer is finding a short region of homology in the m13 tail and producing a primer dimer which is taking over the reaction...can we see a gelpicture and pcr conditions and cycle parameters please? The sequence of one pair of primers that do not work would help with an answer
Hi Paul,
Thank you for your answer! I really appreciated your help.
I didn't see anything on the gel with those two pairs of primers.
The followings are the two pairs of primers that caused the problem. I highlighted the M13 tails. I've checked the primers with online tool, it did not look like that the hairpin structure or primer dimer was causing the problem to me.
F (5’-3’): TGTAAAACGACGGCCAGT GTCCTCAGGGATCAGCACAT
R (5’-3’): GTTTGGATATCGTTCCCGTTGTT
F (5’-3’): CACTGCTTAGAGCGATGC TTTCAATCGTTTGACCATGC
R (5’-3’): GTTTCAAGTCCAAACCGTCCTGTC
I am using 94C 3min for initial denature, 94C 30s, 55C 30s, 72C 45s for 35 cycles, and 72C 10min for elongation.
I am using 25μl pcr reaction which contains:
1x PCR buffer
3mM MgCl2
0.2 mM dNTPs
1 units Taq
0.1µM Primers/each
15ng DNA
Really hope that you can help me out!
Thanks again!
Jing
Hi Jing,
If I am right, you have tested yours primers before adding M13 tail.
I don't know if this is the problem, but you are using a lot of MgCl2 in the reaction. The optimal Mg2+ concentration is variable but in most cases a concentration of
1.5 mM is recommend. You can also increase your ammount of primers to 0.2µM and see if it works.
I have also checked yours primers on OligoAnalyzer (https://www.idtdna.com/calc/analyzer) and your second pair has very different melting temperature. This could be other problem. Did you tried a gradient PCR to optimize the annealing temperature?
Hi Michele,
Thank you!
Yes, I have checked those two pairs of primers before adding M13 tail, they worked well.
I have tried gradient PCR using annealing temperature from 50C to 60C, it did not help.
Thanks for your suggestions, I'll try to increase the amount of perimers and decrease the Mg2+ to see if it works.
Jing
Dear Jing ,
Thank you for the information. I agree with Michele that the Mg is too high. This leads to lower annealing temperatures and primers sticking all over the place and I think that possibly for primer set 1 the motif AACGACGG may anneal to ccgttgtt with only one mismatch which might remove reverse primer from the reaction mix as it becomes useless when extended by 5 bases. Possible solutions use 2-5% DMSO in the mix or use a hot start enzyme which would not allow such a short motif to anneal. The second set is more difficult with only a 5 base gtttg motif annealing to the primer and then not at the 3’ end so is probably not a problem. Here I can offer only generalities.
Possibly run the pcr in presence of 1M betaine to make the template melt easier and ideally in a gradient format as often primers anneal above their calculated Ta and the Ta s are a bit mismatched.
Did you dissolve the primers in water when they arrived. TE should be used as water absorbs CO2 from the air , becomes acidic, and depurinates primers. If using more primer works then this may be what is happening ( and will eventually happen to all the primer sets if all are dissolved in water).
You do not say what dna you are working with. If it is soil based material or plant based sometimes impurities in the dna extract the magnesium from the reacion mixture and it is necessary for the enzyme to work that about 1mM is left for the enzyme. If this is the case with your template then 3mM may not be too high but as Michele says reducing Mg is worth a try
Hopefully it will work soon
Good luck
Paul
Hi Paul,
Thank you for your advice! I'll try to add some DMSO to see if it works.
The DNA sample I am working with was from pure fungal culture, there might be some protein contamination. I am using 3mM of Mg2+ because I am trying to follow the protocol from a paper whose authors developed the those pairs of primers but without M13 tails.
Really hope that I can get them work soon. Thank you again!
Jing
- Badges
- Science method