Hello Guys, I made this count table bar graphs for siRNA I have from RNAseq data of a female organism. overall, the siRNA was low for all BUT ONE loci. Im trying to identify the mRNA regulated by this one siRNA (ACCCATAGATCCGAGCTTGTG) and to understand what is going on but dont know how to go about this. Also, I am open to any suggestion as to what is happening at this one loci and how I can ID the mRNA regulated by the siRNA

More Jacob O Peter's questions See All
Similar questions and discussions