Dear all,

I cloned 25bp fragment into a vector. My no-insert ligation has no colonies and my insert+vector ligation has many. Which is the first clue that I have cloned the fragment.

Than I picked my colonies and sequenced them. But I received totally different results.

I have sequenced crispr-cas9 vector (pSpCas9(BB)-2A-GFP (PX458) ) with u6 forward primer (hU6-F GAGGGCCTATTTCCCATGATT) Normally even if my cloning was a fail I should get empty vector sequence and if the cloning is okay I should get my vector sequence containing 25bp cloned gRNA.

I cloned 3 diffrent oligos. and send 2 colonies for each.

Results of first oligos are indicating that I sequenced SEPTIN7 mRNA.

Results of second oligos are indicating that I sequenced SEPTIN7 ( one of them did not worked the reaction)

Results of third oligo indicated that I cloned a mouse mRNA which is an ion channel ( one of them did not worked the reaction).

and lastly I have sequenced a purified PCR product which is amplifed from HEK293-T DNA, and the reading is so bad, only first part is valuable and it is indicating %100 hit with a spesific E.coli strains 16s rRNA.

I never worked with human or mouse cDNA in this lab. so my plasmid isolations cannot be contaminated with human or mouse cDNA. Actually none is working with human cDNA. (both SEPTIN7 and mouse Ion channels are cDNA, not genomic fragments).

There is no complamentery region in both SEPTIN7 and Ion channel gene with hU6-F primer. So even under a contamination condition my primer should not amplify it.

Before sending to sequencing I have load my purified PCR fragment into gel and it was a single very pure band. I also performed PCR with my plasmids by using F and R primers and checked plasmid quality, there was a very intense band. Figure is attached.

So my question is do you have any idea that Why do I receive these different results which have zero homology with even my vector. My tubes have barcodes, and I send them to sequencing by mixing DNA and primer.

I also attached ABI files.

In gel photo first 6 are colonies, than 100bp marker and the right one is purified PCR product.

More Enes Yağız Akdaş's questions See All
Similar questions and discussions