Dear all,
I cloned 25bp fragment into a vector. My no-insert ligation has no colonies and my insert+vector ligation has many. Which is the first clue that I have cloned the fragment.
Than I picked my colonies and sequenced them. But I received totally different results.
I have sequenced crispr-cas9 vector (pSpCas9(BB)-2A-GFP (PX458) ) with u6 forward primer (hU6-F GAGGGCCTATTTCCCATGATT) Normally even if my cloning was a fail I should get empty vector sequence and if the cloning is okay I should get my vector sequence containing 25bp cloned gRNA.
I cloned 3 diffrent oligos. and send 2 colonies for each.
Results of first oligos are indicating that I sequenced SEPTIN7 mRNA.
Results of second oligos are indicating that I sequenced SEPTIN7 ( one of them did not worked the reaction)
Results of third oligo indicated that I cloned a mouse mRNA which is an ion channel ( one of them did not worked the reaction).
and lastly I have sequenced a purified PCR product which is amplifed from HEK293-T DNA, and the reading is so bad, only first part is valuable and it is indicating %100 hit with a spesific E.coli strains 16s rRNA.
I never worked with human or mouse cDNA in this lab. so my plasmid isolations cannot be contaminated with human or mouse cDNA. Actually none is working with human cDNA. (both SEPTIN7 and mouse Ion channels are cDNA, not genomic fragments).
There is no complamentery region in both SEPTIN7 and Ion channel gene with hU6-F primer. So even under a contamination condition my primer should not amplify it.
Before sending to sequencing I have load my purified PCR fragment into gel and it was a single very pure band. I also performed PCR with my plasmids by using F and R primers and checked plasmid quality, there was a very intense band. Figure is attached.
So my question is do you have any idea that Why do I receive these different results which have zero homology with even my vector. My tubes have barcodes, and I send them to sequencing by mixing DNA and primer.
I also attached ABI files.
In gel photo first 6 are colonies, than 100bp marker and the right one is purified PCR product.
Did you get your vector direct from a company or is it inherited from another researcher. If it is second hand there may be traces of previous work present. Your failed sequences are actually readable manually and it may add some information to view these 2 and get 100 bases of goodish sequence to BLAST ( ignore the G bases being pulled up under the other bases just read the strongest base)
Do you have the vector sequence and are you really inseting only 25 bases if so why are we getting 1600 bases of amplimer.
Did you get your vector direct from a company or is it inherited from another researcher. If it is second hand there may be traces of previous work present. Your failed sequences are actually readable manually and it may add some information to view these 2 and get 100 bases of goodish sequence to BLAST ( ignore the G bases being pulled up under the other bases just read the strongest base)
Do you have the vector sequence and are you really inseting only 25 bases if so why are we getting 1600 bases of amplimer.
Actually I also read them manually. and for your questions,
First since it is a crispr-cas9 vector I think none clone a gene into multiple cloning side(MCS) of the vector. Because it use RNA polymerase 3 promoter which is lack of PolyA tail and MCS is followed by guideRNA fragment which is inserted into the vector. and yes I received it from researcher not the company.
Even if there was traces from previous research when I check the vector's MCS I should see it by PCR. Because when I perform PCR with forward and reverse sequencing primers, I actually amplify the region that contains MCS and the result is the exact nucleotide.
I have the vector sequence it is published on addgene https://www.addgene.org/48138/
The more I think on my problem, normally when sequence the vector with sequencing primers I must see a region from vector ( in my case there is 150bp between MCS and forward primer) but I also don't see this fragment. sequencing results also not matching with my vector.
" Do you have the vector sequence and are you really inseting only 25 bases if so why are we getting 1600 bases of amplimer." I did not understand what you mean with 1600 bases of amplimer?
More interestingly, the HEK293t derived PCR product is so pure and I never mixed it with a bacterial source but I received a bacterial sequencing result from that template.
Maybe it is a bit strange but I think company probably mixed my sample with another person's. Because I went into details with SEPTIN7 sequences and I realized that 2 of them are forward results and one of them is reverse result. Which means that some one is trying to clone SEPTIN7 into a vector and my results are mixed with them. I used only one primer for sequencing so I should not receive both reverse and forward sequencing here.
Thank you for that information Enes but as you have read the short sequences and done the analyses and especially because of the excellent logic concerning the number of sequencing primers I do not think that I can add anything useful to your thinking. My comment about 1600 bases was a rough estimate of the sequence length that you received back but your sequencing could have been from plasmid dna rather than pcr product out of the plasmid and I was surprised that you got so long a read when you only inserted 25bp and was wondering about a typo in the length of the inserted sequence.
Good luck with getting the correct sequence from the company and push for a freebie if you send the template again for sequencing as it does sound very much like their error
all the best
Paul
Today I have called them.
They firstly said my last sequencing quality is not enough to blast it. Than I explained in details for septin7 forward and reverse readings. They said that since I have used mix2seq option, it is not possible to sequence my sample again. They asked me to send a new batch for my samples and they said that they will replace 7 new barcodes for free. Also I asked that in this case they also send some wrong results to other researchers. And the company replied that they did not received a feed back yet. They said they will start a lab investigation etc (typical company words).
In short, they will replace 7 sequencing.
This is not good enough Enes Yağız Akdaş . The 2 mix is not at all relevant. They have cost you valuable time and worry. If 7 barcodes is enough to satisfy you and also get some new sequences done then that is good but if it only takes you to the situation that you paid for and expected to be weeks ago then I think that you could ask for more. Their first comment that your sequencing was not good is nonsense since they do not know which was your sequence and the results they sent you were not that bad....just wrong!
Ask for more and put it in writing ( email) so that they have to admit their error in print.
good luck
paul
- Badges
- Science method
- Similar topics
- Biological Science
- Genetics
- Genetic Analysis
- genetic techniques
- Sequencing