I performed a PCR run on human DNA with the beta-actin primer (F: GCCATCCTGCGTCTGGACCTGGCT; R: GTGATGACCTGGCCGTCAGGCAGC). PCR setting: 98degree 30sec, 30cycle of (98degreeC 10sec, 64degree 30s, 72degree 30sec), followed by extension at 72degree for 5min. The expected band size according to Blast should be 226bp. The product gives me the 226bp band, but I am also seeing multiple larger bands. What might they be?
How can I improve to have only 1 beta actin band? This primer set has been used as internal control by other papers before, but none mentioned about multiple bands.
Thank you.
Hi there! If I were in your shoes, I would start with checking the integrity of my DNA before PCR amplification. Also, I would cross-check my primers with the template DNA for any regions that my primers might bind to apart from binding to my target sites. Also, your primers seem to have a high GC content so, try adding some BSA or DMSO to strengthen the amplification process. Also, always check for primer dimers before running any PCR. All the best!
I think you have to decrease the voltage of the impact power, for example to the 80 V. and be sure the purity and expiration of agarose gel and the TAE buffer.
- Badges
- Science method