5 Questions 1 Answers 0 Followers
Questions related from Pam Pan
We want to do cd68 staining on human cell culture grow on coverslip. However, we are still waiting for the ordered antibody to arrive. So my question is, what is the best way to fix these cells...
02 April 2021 3,666 4 View
Hi all, Is there a way to extract RNA and protein from the same cell culture sample? Because we need to use the protein for gelatin zymography at later time, we are looking for a method that can...
23 February 2021 5,651 5 View
I performed a PCR run on human DNA with the beta-actin primer (F: GCCATCCTGCGTCTGGACCTGGCT; R: GTGATGACCTGGCCGTCAGGCAGC). PCR setting: 98degree 30sec, 30cycle of (98degreeC 10sec, 64degree 30s,...
15 January 2021 6,820 2 View
I conducted a PCR trying to looking for presence of certain bacteria in human tissue. The PCR gave me no band for my human samples, which is fine as it may suggest absent of this bacteria in...
15 January 2021 7,148 4 View
My protein sample is extracted with RIPA + PMSF ( Phenylmethylsulfonyl fluoride). After protein assay, the concentration is too high (>900ug/mL) for direct application for gelatin zymography...
14 December 2020 8,010 3 View