Pam Pan

5 Questions 1 Answers 0 Followers

Questions related from Pam Pan

How can I fix and store cells if I want to do CD68 staining in a later time?

We want to do cd68 staining on human cell culture grow on coverslip. However, we are still waiting for the ordered antibody to arrive. So my question is, what is the best way to fix these cells...

02 April 2021 3,594 4 View

Is there a way to extract total RNA and protein from cell culture at the same time, without denaturing protein?

Hi all, Is there a way to extract RNA and protein from the same cell culture sample? Because we need to use the protein for gelatin zymography at later time, we are looking for a method that can...

23 February 2021 5,529 5 View

Why am I seeing multiple bands for beta-actin PCR?

I performed a PCR run on human DNA with the beta-actin primer (F: GCCATCCTGCGTCTGGACCTGGCT; R: GTGATGACCTGGCCGTCAGGCAGC). PCR setting: 98degree 30sec, 30cycle of (98degreeC 10sec, 64degree 30s,...

15 January 2021 6,717 2 View

Why am I seeing only small band in negative control, when all other samples have no PCR amplification?

I conducted a PCR trying to looking for presence of certain bacteria in human tissue. The PCR gave me no band for my human samples, which is fine as it may suggest absent of this bacteria in...

15 January 2021 7,031 4 View

What can I use to dilute protein for gelatin zymography?

My protein sample is extracted with RIPA + PMSF ( Phenylmethylsulfonyl fluoride). After protein assay, the concentration is too high (>900ug/mL) for direct application for gelatin zymography...

14 December 2020 7,900 3 View