Who has experience with housekeeping genes as reference for qRT-PCR for samples from muscle tissue?

More Felix George's questions See All

Where can I order synthetic miRNAs for spike-in control?

Hi everyone, I'm looking for a supplier of synthetic miRNA (lyophilized) which I can use as spike-in control. I would like to order cel-miR-39 and cel-miR-54. Would be great if someone can help...

05 June 2013 8,705 5 View

Does anybody have experience with miRNA specific for muscle tissues?

I'm looking for specific miRNAs in muscle tissues. There are many articles describing miR-1, miR-122, miR-133a and miR-206 as muscle specific. Are there anymore you know?

02 March 2013 6,415 1 View

How do I increase the yield of my PCR product?

Hello, We would like to increase the yield of our PCR product. We are running a series of PCR reactions that is targeting ~1.1kb sequence. We begin each reaction with ~400pg of template DNA...

02 March 2021 4,029 3 View

Does anyone know HRM channel in a 2 plex QIAGEN Rotor- Gene Q qPCR can be used as a separate channel?

I am going to have 3 different probes in my qPCR work that I am going to do. But I realized that the machine we have in the lab is a Rotor-Gene Q 2plex HRM Platform, saying it has green, yellow,...

01 March 2021 8,544 1 View

How to address this issue in the analysis of Real-Time PCR results?

To dear Researchers, I was analyzing a series of concentration for estimation of Real-Time PCR efficiency. The concentration was 1:10. I used MS-excel to evaluate Slope. The result of slope was -8...

01 March 2021 8,683 4 View

No title

Does anyone have the experience of using Taq Man probes in the QIAGEN Rotar- Gene qPCR machine?

01 March 2021 5,311 1 View

Is it possible for two human neuronal cell lines to have different gene sequence for the same protein?

I am looking at the ATP1A2 (Sodium/Potassium ATPase alpha subunit 2) in two human neuronal cell lines. Expression levels of this protein seems to be almost equal when detected by one antibody....

01 March 2021 3,607 3 View

Genome-wide gene identification protocol ?

Is there any book chapter/book, webpage or research article available to understand genome-wide gene identification?

28 February 2021 8,095 1 View

MiRNA qpcr problem?

Dear All, mirna primer showing some problem in the melting curve? any idea why? As attached is the melting curve. The forward sequence is obtained from miRBase and reverse primer is universal.

28 February 2021 5,008 4 View

Any specific pipeline or parameter to analyse total transcriptomics study of brain tissue samples?

I have two groups of brain samples, control and treated for example. It was total RNA nova seq sequencing. I tried all the available pipeline like: star+rsem+deseq2, Hista+stringtie+cuffdiff,...

27 February 2021 356 6 View

Runs of nucleotides in Sanger sequencing?

I performed site directed mutagenesis, transformation, and then I sent out plasmids for Sanger sequencing and found out that there is extension of DNA just before the stop codon. I am not sure...

27 February 2021 547 3 View

Can thermal cycler machines be problematic during PCR?

Hi, my question is about the heating of thermal cycler machines and I hope some of you had experienced a similar thing previously. There are two thermal cycler machines in the lab(BioRad) and for...

26 February 2021 4,777 4 View

Elisabeth Buchberger

You cold also use 36B4 (acidic ribosomal phosphoprotein)

Works nicely and is stable.

NM_001002.3; NM_053275.3

FWD: CGCACCGCCGTGATG

REV: AATAGTTGGATGATCTTAAGGAAGTAGTTG

PROBE: AAGACAGGGCGACCTG

Felix George

Thanks for your answer. I'll think about to use it for my investigations with miRNA. The sequence is short so maybe it is useful.

EDIT: DId you work with mice or rats?