Which is the best software to simulate chemistry of materials in correlation with their mechanical properties ?

More Padmanabhan Krishnan's questions See All

Why do we need to neutralize the charge of the system by adding ions before we proceed to energy minimization step in GROMACS ?

I am learning MD simulations using GROMACS and while I was doing a protein in water MD simulation a doubt raised. I was following the steps mentioned on the tutorials page and it said The system...

15 February 2021 5,514 4 View

Divergence detected in AMG solver for temperature and species , DEFINE_VR_RATE, Fluent ?

In 2D Model, Reaction in porous Zone, Error occurs on hooking UDF , DEFINE_VR_RATE in Fluent, .The error spikes just after running calculation after 1st iteration. Divergence detected in AMG...

16 November 2020 9,053 3 View

How to verify if a measuring system is working right?

We have 2 machines that test products. Both of these qualify the product to be Good or Bad ( Based on amount of leak ). The final outcome is attribute variable (Good/ Bad) whereas the way we...

16 November 2020 688 7 View

How to create a surface plot and contour? If i have an excel file with X, Y ,Z values of the surface ( Periphery of a tube) and Q (heat flux) value.?

Need to create 3d surface plot. Data I have X, Y ,Z coordinate of the pipe surface and the corresponding Q (heat flux) values at that point. Nearly 222440 data points of a 2m length pipe. Thank you

07 October 2020 9,854 7 View

Initialization in Fluent? Hybrid initialization or Standard initialization ?

Looking towards an incompressible flow (with K-e, turbulence model), with mass flow/velocity inlet and Pressure outlet boundary condition. Which initialization method preferred? How far it can...

05 October 2020 4,742 5 View

Why did it take humanity so long to start writing though we have been speaking for tens of thousands of years ?

They say we were just speaking and not writing anything for tens of thousands of years till a basic form of writing evolved just about ten thousand years back. Why this yawning gap ?

22 September 2020 5,313 7 View

Is there any cost-effective, simple and efficient way to analyse and estimate the amount of vitamins in algal samples?

I am currently pursuing my research in Phycology. I'd like to know if there's any simple and cost-effective method to detect and analyze nutrients and vitamins in the algal matter. The experiment...

18 September 2020 4,081 3 View

Which research institutes in India have an algal identification facility?

I am currently pursuing my research in Phycology and planning to conduct a study on microalgae. Is there any place where I can send my samples to be identified? (Preferably in South India) Also,...

17 September 2020 4,440 2 View

How is the co-expressed genes regulatory network plotted? Is there any Bioinformatics tool for the same?

Hi, I am working on molecular validation of co-expressed genes in Rice under moisture stress. I have a list of genes that are co-expressed in three rice varieties, under a particular set of...

12 July 2020 7,494 1 View

Will three missing nucleotides on the 3' end of the forward primer result in no annealing?

Hello everyone, I ordered forward and reverse primers for oligo annealing for guided RNA cloning. Instead of this primer (5' CTTCGCTAGAGGCGTGGCCAGGGG 3'), I ordered this...

25 March 2020 551 5 View

MD MOE RMSD

How to calculate the RMSD values for a MD simulation using MOE?

07 August 2021 0 0 View

MD MOE RMSD

How to calculate the RMSD values for a MD simulation using MOE?

07 August 2021 0 0 View

fatal error

When I tried to energy minimization my system, I got fatal error as below. Fatal error: Atomtype opls_116 not found Although I've already added this line: ; include water #include "oplsaa.ff/spc.itp" to [molecultype] directive in my topology.

16 June 2021 0 0 View

fatal error

16 June 2021 0 0 View

fatal error

16 June 2021 0 0 View

fatal error

16 June 2021 0 0 View

flexibility of polymers chain

effect of double bond on the flexibility of polymers

07 April 2021 0 0 View

Formulation of polymer color flakes

I am writing to request some information for making polymer color flakes. I would appreciate the help.

17 March 2021 0 0 View

What is the production process of CaFe ferroalloys?

I looking for ferro calcium production process

03 March 2021 1,755 4 View

Resistor definition in Piezoelectric bimorph with ANSYS workbench

Hello, good day! I am trying to simulate similar bimorph piezoelectric harvester with below commands. However, the output power doesn't change with resistor value. Please help to find the reason. ET,10,CIRCU94,0 !SET UP RESISTOR R,1,100000 !RESISTANCE VALUE TYPE,10 !SET ELEMENT TYPE E,1,2 !CREATE RESISTOR BETWEEN NODES 1 AND 2 Thanks in advance Regards,

02 March 2021 0 0 View