Florian is right, you should test several candidates to find out which works best for your cultivar and your conditions. In my hands Elongation factor 1 alpha won the competition in tomato, pepper and some other nightshade plants (Primers from DOI:10.1111/j.1469-8137.2010.03346.x : eEF1Art-f AGTCAACTACCACTGGTCAC;
eEF1Art-r GTGCAGTAGTACTTAGTGGTC) Ubiquitin was unusable because of multiple copies/alleles; Cyclophilin was also used sometimes but had some circadian rhythm dependency. I never tried actin, because I read it was not reliable in some experiments. At least for pepper one should also avoid GAPDH, don't know if this is true for tomato.
HTH,
Robert
What do you mean exactly with internal control? The reference gene for normalization of your gene expression? This is hard to say... Normally you should test which reference gene is the most stable one under your condition.
Hi Raksha, I used the β-actin as internal reference and it worked well.
However, there are a few reports claiming that is cell cycle dependent and not consistently regulated under different conditions.
You can find more genes in this article: Selection of internal control genes for quantitative real-time RT-PCR studies during tomato development process. Marino Expósito- Rodríguez, Andrés A Borges, Andrés Borges-Pérez and José A Pérez
Florian is right, you should test several candidates to find out which works best for your cultivar and your conditions. In my hands Elongation factor 1 alpha won the competition in tomato, pepper and some other nightshade plants (Primers from DOI:10.1111/j.1469-8137.2010.03346.x : eEF1Art-f AGTCAACTACCACTGGTCAC;
eEF1Art-r GTGCAGTAGTACTTAGTGGTC) Ubiquitin was unusable because of multiple copies/alleles; Cyclophilin was also used sometimes but had some circadian rhythm dependency. I never tried actin, because I read it was not reliable in some experiments. At least for pepper one should also avoid GAPDH, don't know if this is true for tomato.
HTH,
Robert
Selection of suitable internal control in Q-PCR is challenging jobs, as many experimental condition cause change in the expression of House keeping gene. As in my experiments in lung Biology, i found a lot of various in the expression of Internal gene while treating mice with LPS, Bleomycin etc. Internal control for one mice strain may not be suitable for other strains. Even the treatment time itself cause some variation in the expression of internal gene expression. Though there are some literature available for using a particular internal gene in TOMATO. i can suggest you that please test some Internal keeping gene (at least 6 setts) for selecting best Internal control gene in your experimental condition (Treatment drugs, Salt tolerance etc ). I feel this is very very important step in Real time PCR. Even half one cycle of Ct value control sample and test sample cause more than 1.5 fold changes of target gene which is apparently not true.
In short, i can suggest you to test few set of internal gene at your experimental condition before making any conclusion of your result.
Thanks good luck
26S rRNA universal primers works well for all Eukaryotes: this includes plant and animals.
This might be useful for you:
http://www.biomedcentral.com/1471-2229/8/131
Generally, check papers and compare their housekeeping gene.
Normally for plants you use UBQ and it works well!
Cheers!
Raksha, the answer to your question is easy: ubiquitin gene. Please, read the following paper
Mol Plant Pathol. 2010 Nov;11(6):805-16. doi: 10.1111/j.1364-3703.2010.00646.x.
Evaluation of reference genes for quantitative reverse-transcription polymerase chain reaction normalization in infected tomato plants.
Mascia T, Santovito E, Gallitelli D, Cillo F.
Enjoy
A little bit specific querry would fetch you a precise answer. There are several qPCR that has been done with genes from tomato, like for example the lycopene producing genes, the genes responsible for maturity of different tomato variety etc. I am sure you want to do qPCR for some specific purpose and it will have its own internal control gene. Do reply for a better answer.
- Badges
- Science topic
- Similar topics
- Biological Science
- Molecular Biology