Good day, everyone!
I'd want to know the name of the free software that can be used to create graphical abstracts and illustrated diagrams for research/review papers. Several researchers will benefit from sharing the link.
Thanks in advance.
Perhaps you can try: https://www.diagrams.net/
free, high quality diagramming software for flowcharts or diagrams, which allow online collaboration as well...
Next, I recommend to check this website:
https://www.ilovephd.com/what-is-graphical-abstract-how-to-create-one/
Origine
You may use draw.io and GraphPad
visio
Use inkscape
If you need help, I recommend peakcells.com
They are super helpful and design beautiful and informative 2D and 3D scientific and medical visualizations.
I usually use biorender but it is not free. You can try.
BioRender! (https://biorender.io/)
I find making them on the Microsoft PowerPoint and exporting as jpeg is convenient. Have been using this mode for a while now, and successfully.
Dear Nadeem Rais
Latex overleaf and BioRender are good options.
Microsoft Visio
Nadeem Rais If you are interested you design 3D structures in your graphical abstract then I recommend Adobe Photoshop and Adobe Illustrators.
You can also improve your graphical abstract by using other free online software where you can find prepared icons:
1. Biorender (https://biorender.com/)
2. Mid the graph (https://mindthegraph.com/).
Smartdraw is very good and easy tool from Microsoft.
However, it is free for initial few diagrams only.
I suggest you can use:
https://app.diagrams.net/#
I would recommend BioRender https://biorender.com/
BioRender is the best
Matlab
Biorender
If you use R then DiagrammeR
Adobe Illustrator is best for illustrations
Hi
I've heard about canva many times but I didnt use it yet
Microsoft PowerPoint
Canva is a good one.
If you use R, ggplot2 is your friend; if python then matplotlib. I also use Microsoft Excel sometimes too
Adobe Illustration
Envi-met software
07 August 2024 8,188 1 View
The entropy measured of molecular graphs plays a crucial rule. The network structures in some cases are very lengthy calculations to handle. Some author avoid to construct table where as most...
30 July 2024 3,126 0 View
The first step is to analyze a 2D molecular graph and implement partitioning techniques to calculate the topological indices. Secondly impose statically tools to generate QSPR model, may or may...
24 July 2024 9,644 1 View
Most of the time it is observed that in many manuscripts there are several typo error of topological calculation errors of calculation and partition of edges what ever the type of partitioning it...
22 July 2024 811 0 View
I have been trying to grow Nicotiana benthamiana via tissue culture. I used ethanol and sodium hypochlorite with different concentrations and time duration for seeds sterilization and lastly...
18 June 2024 1,756 3 View
can any budy explain how i calculate the DNA concentration for the 50ul reaction?
22 May 2024 9,557 1 View
If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...
22 May 2024 7,777 1 View
The QSPR analysis some time fails to produce relevant answer. what we should do to get improve results.
29 August 2023 7,764 2 View
Where as some authors use 2d model and other use 3d model. How we can distinguish what the difference. Are the results same or different?
27 August 2023 552 2 View
I'm looking for a mathematical model for transfer of heat in human body organs especially (eye, heart, brain and lungs). How is the behavior of heat transfer at normal and extreme levels
12 July 2023 4,888 2 View
"PUBLISHING IN A SCOPUS JOURNAL" Researchers are now at a cross road. The critical need to publish in a Scopus or ISI, etc journal is ever vital. Journal Publication fees must be submitted....
10 August 2024 8,621 1 View
Hello experts, Does anyone know any free software about retention index prediction ?
08 August 2024 7,403 2 View
How we can cite the papers from ResearchGate. I am trying to create citations for this article, Quantum Machine Learning Algorithms for Optimization Problems: Theory, Implementation, and...
08 August 2024 6,690 3 View
Hello dear colleagues, We have prepared a manuscript on NiTi-based alloys and are seeking a second opinion on our current TEM results. If you are a Ph.D. holder with experience in TEM and have...
07 August 2024 9,563 0 View
The first pdf file I uploaded had an error. So I uploaded an updated, corrected pdf of that paper with a different pdf name. I dpon't want the old copy to be download or read.
07 August 2024 9,508 1 View
how to get links for copyrights for papers?
06 August 2024 7,410 1 View
To compare positive and negative cell populations in flow cytometry, should I compare unstained cells with antibody stained cells? Or with the isotype control? Most papers show comparison with...
06 August 2024 6,728 6 View
Chimnya
05 August 2024 6,947 1 View
Dear friends, does anybody know that is it legal to upload a graphical abstract previously published on your paper's first page to a website such as figshare.com under CC-BY-4.0 license? Thanks.
05 August 2024 7,098 3 View
I have an antibody binding generic protein and I need to compare its activity in a free and immobolized form. I understand that there are a number of methods to determine Kd value of a free...
05 August 2024 5,311 0 View