Dear Scientists

In order to be sure about the sequence of Qiagen miRNeasy Serum/Plasma Spike-In Control (cat. no 219610) cel-miR-39, you can go through the very recent artical mentioned below:

Hara et al. Acta Neuropathologica Communications (2017) 5:10

https://actaneurocomms.biomedcentral.com/track/pdf/10.1186/s40478-017-0414-z?site=actaneurocomms.biomedcentral.com

In the RNA extraction section of the article it is mentioned as follows :

For quantitative reverse transcription PCR (qRT-PCR) assay of the NIG validation set, 5.6 × 108 copies of synthetic cel-miR-39-3p (miRNeasy Serum/ Plasma Spike-In Control; QIAGEN) were added to each serum sample to normalize and monitor extraction efficiency.

Which confirms the the (cat. no 219610) cel-miR-39 is synthetic cel-miR-39-3p.

Species:Caenorhabditis elegans

Mature miRNA Sequence: UCACCGGGUGUAAAUCAGCUUG

Dear Maciej

Greeting,

I faced the same problem with Exiqon company as this is a nowhow or specific to them, but they gave me the product size and the Tm of it.

this is the situation otherwise you have to design your own primers to get all of the required information.

salam

Dear Najat, 

The case is, that I want to use Qiagen Spike-in synthetic RNA oligo during the RNA isolation, but detect it with the TaqMan.  This is why I needed to know what is the sequence of Qiagen's cel-mir-39. 

Finally I called the Qiagen Technical Support in the US, and they told me, that Qiagen miRNeasy Serum/Plasma Spike-In Control (cat. no 219610) is cel-miR-39-3p.

Maciej

Dear Scientists

In order to be sure about the sequence of Qiagen miRNeasy Serum/Plasma Spike-In Control (cat. no 219610) cel-miR-39, you can go through the very recent artical mentioned below:

Hara et al. Acta Neuropathologica Communications (2017) 5:10

https://actaneurocomms.biomedcentral.com/track/pdf/10.1186/s40478-017-0414-z?site=actaneurocomms.biomedcentral.com

In the RNA extraction section of the article it is mentioned as follows :

For quantitative reverse transcription PCR (qRT-PCR) assay of the NIG validation set, 5.6 × 108 copies of synthetic cel-miR-39-3p (miRNeasy Serum/ Plasma Spike-In Control; QIAGEN) were added to each serum sample to normalize and monitor extraction efficiency.

Which confirms the the (cat. no 219610) cel-miR-39 is synthetic cel-miR-39-3p.

Species:Caenorhabditis elegans

Mature miRNA Sequence: UCACCGGGUGUAAAUCAGCUUG

Thank you Maciej Zacharski and Dr. Jamsheed Javid!

This helped me a lot.

what is the product size?

Dear Ankit,

The size of the product (I suppose, you mean PCR product) probably depends on the method you use for cDNA preparation, however the size of the cel-miR-39-3p itself is 22 bp. You can check it in the miRBase: http://www.mirbase.org/cgi-bin/mirna_entry.pl?acc=MI0000010

Dear Maciej Zacharski ,

did you manage to use Qiagen Spike-in synthetic RNA oligo and make the detection with TaqMan Assays? I have this problem, right now. Moreover, the TaqMan miRNA Assays Guidelines says that the oligonucleotides for exogenous controls must be 5'-phosphorylated.

Can you help me with tour experience?

Thank you!

Sara